EMAIL THIS PAGE TO A FRIEND

CSN1S1

casein alpha s1

91 Gene Product Result for
Synonyms: CASA CSN1
UniProtKB ID: P47710, A1A510, A1A511, E9PB60, Q4PNR5
Gene ID:
Mouse(12990) casein alpha s1
Rat(24284) casein alpha s1
dog(611749) casein alpha s1
Horse(100033982) casein alpha s1
cow(282208) casein alpha s1
Goat(100750242) casein alpha s1
Domestic Rabbit(100009257) casein alpha s1
sheep(443382) casein alpha s1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001890 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001890 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001890 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007784 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007784 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007784 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU189561 MISSION® esiRNA esiRNA targeting mouse Csn1s1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025104 Rosetta Predictions human pricing
NM_001890 Rosetta Predictions human pricing
NM_138874 Rosetta Predictions rat pricing
NM_007784 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025104 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039875 predicted 559
2 SASI_Hs01_00039876 predicted 566
3 SASI_Hs01_00039877 predicted 693
4 SASI_Hs01_00039878 predicted 700
5 SASI_Hs01_00039879 predicted 664
6 SASI_Hs02_00307368 predicted 517
7 SASI_Hs02_00307369 predicted 563
8 SASI_Hs01_00039881 predicted 557
9 SASI_Hs01_00039882 predicted 627
10 SASI_Hs01_00039883 predicted 561
11 SASI_Hs01_00039880 predicted 675
12 SASI_Hs01_00039884 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082214 predicted 583
2 SASI_Hs01_00082215 predicted 588
3 SASI_Hs01_00082217 predicted 719
4 SASI_Hs01_00082218 predicted 726
5 SASI_Hs01_00082219 predicted 691
6 SASI_Hs02_00332754 predicted 553
7 SASI_Hs02_00332755 predicted 594
8 SASI_Hs01_00082221 predicted 587
9 SASI_Hs01_00082222 predicted 657
10 SASI_Hs01_00082223 predicted 588
11 SASI_Hs01_00082216 predicted 552
12 SASI_Hs01_00082220 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138874 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268289 predicted 967
2 SASI_Rn02_00268290 predicted 709
3 SASI_Rn02_00268291 predicted 822
4 SASI_Rn02_00268292 predicted 753
5 SASI_Rn02_00268293 predicted 939
6 SASI_Rn02_00268294 predicted 698
7 SASI_Rn02_00268295 predicted 249
8 SASI_Rn02_00268296 predicted 262
9 SASI_Rn02_00268297 predicted 715
10 SASI_Rn02_00268298 predicted 937
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007784 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172310 predicted 344
2 SASI_Mm01_00172311 predicted 350
3 SASI_Mm01_00172312 predicted 880
4 SASI_Mm01_00172313 predicted 979
5 SASI_Mm01_00172314 predicted 348
6 SASI_Mm01_00172315 predicted 257
7 SASI_Mm01_00172317 predicted 849
8 SASI_Mm02_00312452 predicted 226
9 SASI_Mm02_00312453 predicted 737
10 SASI_Mm02_00312454 predicted 908
11 SASI_Mm01_00172309 predicted 970
12 SASI_Mm01_00172316 predicted 793
13 SASI_Mm01_00172318 predicted 770
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001890
CSN1S1 MISSION shRNA Bacterial Glycerol Stock
casein alpha s1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001890.1-731s21c1
Sequence:CCGGCTACTTAATAGCATATCATTCCTCGAGGAATGATATGCTATTAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001890.1-595s21c1
Sequence:CCGGGCTACAGTGGTGATATGATTGCTCGAGCAATCATATCACCACTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001890.1-310s21c1
Sequence:CCGGCAGTTCATCGAGTGAGGAAATCTCGAGATTTCCTCACTCGATGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001890.1-506s1c1
Sequence:CCGGCCACAAATCATGCAGTATGTTCTCGAGAACATACTGCATGATTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001890.1-406s1c1
Sequence:CCGGCCAGGAGCAAATTCGCAGAATCTCGAGATTCTGCGAATTTGCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001890.1-150s1c1
Sequence:CCGGGTGAGCCTATACCATTAGAATCTCGAGATTCTAATGGTATAGGCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001890.1-485s1c1
Sequence:CCGGCCCTATGCTGTTTGGTACTATCTCGAGATAGTACCAAACAGCATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001890.1-93s1c1
Sequence:CCGGCCAGGCCTAAACTTCCTCTTACTCGAGTAAGAGGAAGTTTAGGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001890
CSN1S1 MISSION shRNA shRNA Plasmid DNA
casein alpha s1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001890.1-731s21c1
Sequence:CCGGCTACTTAATAGCATATCATTCCTCGAGGAATGATATGCTATTAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001890.1-595s21c1
Sequence:CCGGGCTACAGTGGTGATATGATTGCTCGAGCAATCATATCACCACTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001890.1-310s21c1
Sequence:CCGGCAGTTCATCGAGTGAGGAAATCTCGAGATTTCCTCACTCGATGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001890.1-506s1c1
Sequence:CCGGCCACAAATCATGCAGTATGTTCTCGAGAACATACTGCATGATTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001890.1-406s1c1
Sequence:CCGGCCAGGAGCAAATTCGCAGAATCTCGAGATTCTGCGAATTTGCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001890.1-150s1c1
Sequence:CCGGGTGAGCCTATACCATTAGAATCTCGAGATTCTAATGGTATAGGCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001890.1-485s1c1
Sequence:CCGGCCCTATGCTGTTTGGTACTATCTCGAGATAGTACCAAACAGCATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001890.1-93s1c1
Sequence:CCGGCCAGGCCTAAACTTCCTCTTACTCGAGTAAGAGGAAGTTTAGGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001890
CSN1S1 MISSION shRNA Lentiviral Transduction Particles
casein alpha s1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001890.1-731s21c1
Sequence:CCGGCTACTTAATAGCATATCATTCCTCGAGGAATGATATGCTATTAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001890.1-595s21c1
Sequence:CCGGGCTACAGTGGTGATATGATTGCTCGAGCAATCATATCACCACTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001890.1-310s21c1
Sequence:CCGGCAGTTCATCGAGTGAGGAAATCTCGAGATTTCCTCACTCGATGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001890.1-506s1c1
Sequence:CCGGCCACAAATCATGCAGTATGTTCTCGAGAACATACTGCATGATTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001890.1-406s1c1
Sequence:CCGGCCAGGAGCAAATTCGCAGAATCTCGAGATTCTGCGAATTTGCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001890.1-150s1c1
Sequence:CCGGGTGAGCCTATACCATTAGAATCTCGAGATTCTAATGGTATAGGCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001890.1-485s1c1
Sequence:CCGGCCCTATGCTGTTTGGTACTATCTCGAGATAGTACCAAACAGCATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001890.1-93s1c1
Sequence:CCGGCCAGGCCTAAACTTCCTCTTACTCGAGTAAGAGGAAGTTTAGGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007784
CSN1S1 MISSION shRNA Bacterial Glycerol Stock
casein alpha s1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007784.2-849s1c1
Sequence:CCGGCCCACAAATCTTCCAGTATGACTCGAGTCATACTGGAAGATTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007784.2-1148s1c1
Sequence:CCGGGCCAATGATTCATCTTGAGTTCTCGAGAACTCAAGATGAATCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007784.2-430s1c1
Sequence:CCGGCAGTTTAAGTACAACCAACTTCTCGAGAAGTTGGTTGTACTTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007784.2-1176s1c1
Sequence:CCGGGCATATTAGATAGCATAGCATCTCGAGATGCTATGCTATCTAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007784.2-850s1c1
Sequence:CCGGCCACAAATCTTCCAGTATGATCTCGAGATCATACTGGAAGATTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007784.2-246s1c1
Sequence:CCGGCGATGAAATCAAGGTAACTATCTCGAGATAGTTACCTTGATTTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007784
CSN1S1 MISSION shRNA shRNA Plasmid DNA
casein alpha s1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007784.2-849s1c1
Sequence:CCGGCCCACAAATCTTCCAGTATGACTCGAGTCATACTGGAAGATTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007784.2-1148s1c1
Sequence:CCGGGCCAATGATTCATCTTGAGTTCTCGAGAACTCAAGATGAATCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007784.2-430s1c1
Sequence:CCGGCAGTTTAAGTACAACCAACTTCTCGAGAAGTTGGTTGTACTTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007784.2-1176s1c1
Sequence:CCGGGCATATTAGATAGCATAGCATCTCGAGATGCTATGCTATCTAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007784.2-850s1c1
Sequence:CCGGCCACAAATCTTCCAGTATGATCTCGAGATCATACTGGAAGATTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007784.2-246s1c1
Sequence:CCGGCGATGAAATCAAGGTAACTATCTCGAGATAGTTACCTTGATTTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007784
CSN1S1 MISSION shRNA Lentiviral Transduction Particles
casein alpha s1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007784.2-849s1c1
Sequence:CCGGCCCACAAATCTTCCAGTATGACTCGAGTCATACTGGAAGATTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007784.2-1148s1c1
Sequence:CCGGGCCAATGATTCATCTTGAGTTCTCGAGAACTCAAGATGAATCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007784.2-430s1c1
Sequence:CCGGCAGTTTAAGTACAACCAACTTCTCGAGAAGTTGGTTGTACTTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007784.2-1176s1c1
Sequence:CCGGGCATATTAGATAGCATAGCATCTCGAGATGCTATGCTATCTAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007784.2-850s1c1
Sequence:CCGGCCACAAATCTTCCAGTATGATCTCGAGATCATACTGGAAGATTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007784.2-246s1c1
Sequence:CCGGCGATGAAATCAAGGTAACTATCTCGAGATAGTTACCTTGATTTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks