EMAIL THIS PAGE TO A FRIEND

CSN2

casein beta

56 Gene Product Result for
Synonyms: CASB
UniProtKB ID: P05814, Q4VAZ9, Q9UCM5
Gene ID:
Mouse(12991) casein beta
Rat(29173) casein beta
cow(281099) casein beta
dog(403644) casein beta
Horse(100033903) casein beta
Goat(100860784) casein beta
Goat(100750240) casein beta
sheep(443391) casein beta
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009972 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009972 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009972 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001891 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001891 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001891 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU051351 MISSION® esiRNA esiRNA targeting mouse Csn2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001891 Rosetta Predictions human pricing
NM_017120 Rosetta Predictions rat pricing
NM_009972 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332756 predicted 304
2 SASI_Hs01_00225876 predicted 349
3 SASI_Hs01_00225877 predicted 360
4 SASI_Hs01_00225878 predicted 200
5 SASI_Hs01_00225879 predicted 293
6 SASI_Hs01_00225880 predicted 474
7 SASI_Hs01_00225881 predicted 599
8 SASI_Hs01_00225882 predicted 474
9 SASI_Hs01_00225883 predicted 360
10 SASI_Hs01_00225884 predicted 350
11 SASI_Hs01_00225875 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017120 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058328 predicted 208
2 SASI_Rn01_00058329 predicted 283
3 SASI_Rn01_00058330 predicted 549
4 SASI_Rn02_00261359 predicted 344
5 SASI_Rn02_00261360 predicted 527
6 SASI_Rn01_00058332 predicted 375
7 SASI_Rn02_00261361 predicted 211
8 SASI_Rn01_00058336 predicted 273
9 SASI_Rn02_00261362 predicted 359
10 SASI_Rn02_00261363 predicted 393
11 SASI_Rn01_00058331 predicted 395
12 SASI_Rn01_00058333 predicted 532
13 SASI_Rn01_00058334 predicted 531
14 SASI_Rn01_00058335 predicted 372
15 SASI_Rn01_00058337 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009972 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058565 predicted 708
2 SASI_Mm01_00058566 predicted 639
3 SASI_Mm02_00317554 predicted 733
4 SASI_Mm02_00317555 predicted 701
5 SASI_Mm02_00317556 predicted 667
6 SASI_Mm02_00317557 predicted 800
7 SASI_Mm01_00058571 predicted 676
8 SASI_Mm01_00058573 predicted 740
9 SASI_Mm02_00317558 predicted 635
10 SASI_Mm01_00058574 predicted 663
11 SASI_Mm01_00058567 predicted 413
12 SASI_Mm01_00058568 predicted 224
13 SASI_Mm01_00058569 predicted 382
14 SASI_Mm01_00058570 predicted 286
15 SASI_Mm01_00058572 predicted 608
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009972
CSN2 MISSION shRNA Bacterial Glycerol Stock
casein beta
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000120852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009972.1-790s1c1
Sequence:CCGGGAACTGACTGAAACTGGAAATCTCGAGATTTCCAGTTTCAGTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009972.1-463s1c1
Sequence:CCGGCCGCCTCATAAACTCTCAAATCTCGAGATTTGAGAGTTTATGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009972.1-161s1c1
Sequence:CCGGGAACATATCAATGAGCAGAAACTCGAGTTTCTGCTCATTGATATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009972.1-653s1c1
Sequence:CCGGCCACAAGATATGTCTGTCCAACTCGAGTTGGACAGACATATCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009972
CSN2 MISSION shRNA shRNA Plasmid DNA
casein beta
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000120852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009972.1-790s1c1
Sequence:CCGGGAACTGACTGAAACTGGAAATCTCGAGATTTCCAGTTTCAGTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009972.1-463s1c1
Sequence:CCGGCCGCCTCATAAACTCTCAAATCTCGAGATTTGAGAGTTTATGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009972.1-161s1c1
Sequence:CCGGGAACATATCAATGAGCAGAAACTCGAGTTTCTGCTCATTGATATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009972.1-653s1c1
Sequence:CCGGCCACAAGATATGTCTGTCCAACTCGAGTTGGACAGACATATCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009972
CSN2 MISSION shRNA Lentiviral Transduction Particles
casein beta
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000120852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009972.1-790s1c1
Sequence:CCGGGAACTGACTGAAACTGGAAATCTCGAGATTTCCAGTTTCAGTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009972.1-463s1c1
Sequence:CCGGCCGCCTCATAAACTCTCAAATCTCGAGATTTGAGAGTTTATGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009972.1-161s1c1
Sequence:CCGGGAACATATCAATGAGCAGAAACTCGAGTTTCTGCTCATTGATATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009972.1-653s1c1
Sequence:CCGGCCACAAGATATGTCTGTCCAACTCGAGTTGGACAGACATATCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001891
CSN2 MISSION shRNA Bacterial Glycerol Stock
casein beta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001891.1-201s1c1
Sequence:CCGGCCTCTGATCTATCCATTCGTTCTCGAGAACGAATGGATAGATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001891.1-88s1c1
Sequence:CCGGGTGAGGAATCTATTACAGAATCTCGAGATTCTGTAATAGATTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001891.1-303s1c1
Sequence:CCGGGAAATAATGGAAGTCCCTAAACTCGAGTTTAGGGACTTCCATTATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001891.1-363s1c1
Sequence:CCGGGTCCTTAAATCTCCAACGATACTCGAGTATCGTTGGAGATTTAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001891.1-607s1c1
Sequence:CCGGTCAACCAAGAACTTCTACTTACTCGAGTAAGTAGAAGTTCTTGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001891.2-81s21c1
Sequence:CCGGCAAGCAGTGAGGAATCTATTACTCGAGTAATAGATTCCTCACTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001891.2-308s21c1
Sequence:GTACCGGATGGAAGTCCCTAAAGCTAAACTCGAGTTTAGCTTTAGGGACTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001891.2-351s21c1
Sequence:CCGGGAGTGATGCCTGTCCTTAAATCTCGAGATTTAAGGACAGGCATCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001891.2-607s21c1
Sequence:CCGGCAACCAAGAACTTCTACTTAACTCGAGTTAAGTAGAAGTTCTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001891.2-877s21c1
Sequence:CCGGTTTGACTCATGAACTATTTACCTCGAGGTAAATAGTTCATGAGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001891
CSN2 MISSION shRNA shRNA Plasmid DNA
casein beta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001891.1-201s1c1
Sequence:CCGGCCTCTGATCTATCCATTCGTTCTCGAGAACGAATGGATAGATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001891.1-88s1c1
Sequence:CCGGGTGAGGAATCTATTACAGAATCTCGAGATTCTGTAATAGATTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001891.1-303s1c1
Sequence:CCGGGAAATAATGGAAGTCCCTAAACTCGAGTTTAGGGACTTCCATTATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001891.1-363s1c1
Sequence:CCGGGTCCTTAAATCTCCAACGATACTCGAGTATCGTTGGAGATTTAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001891.1-607s1c1
Sequence:CCGGTCAACCAAGAACTTCTACTTACTCGAGTAAGTAGAAGTTCTTGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001891.2-81s21c1
Sequence:CCGGCAAGCAGTGAGGAATCTATTACTCGAGTAATAGATTCCTCACTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001891.2-308s21c1
Sequence:GTACCGGATGGAAGTCCCTAAAGCTAAACTCGAGTTTAGCTTTAGGGACTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001891.2-351s21c1
Sequence:CCGGGAGTGATGCCTGTCCTTAAATCTCGAGATTTAAGGACAGGCATCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001891.2-607s21c1
Sequence:CCGGCAACCAAGAACTTCTACTTAACTCGAGTTAAGTAGAAGTTCTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001891.2-877s21c1
Sequence:CCGGTTTGACTCATGAACTATTTACCTCGAGGTAAATAGTTCATGAGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001891
CSN2 MISSION shRNA Lentiviral Transduction Particles
casein beta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001891.1-201s1c1
Sequence:CCGGCCTCTGATCTATCCATTCGTTCTCGAGAACGAATGGATAGATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001891.1-88s1c1
Sequence:CCGGGTGAGGAATCTATTACAGAATCTCGAGATTCTGTAATAGATTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001891.1-303s1c1
Sequence:CCGGGAAATAATGGAAGTCCCTAAACTCGAGTTTAGGGACTTCCATTATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001891.1-363s1c1
Sequence:CCGGGTCCTTAAATCTCCAACGATACTCGAGTATCGTTGGAGATTTAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001891.1-607s1c1
Sequence:CCGGTCAACCAAGAACTTCTACTTACTCGAGTAAGTAGAAGTTCTTGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001891.2-81s21c1
Sequence:CCGGCAAGCAGTGAGGAATCTATTACTCGAGTAATAGATTCCTCACTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001891.2-308s21c1
Sequence:GTACCGGATGGAAGTCCCTAAAGCTAAACTCGAGTTTAGCTTTAGGGACTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001891.2-351s21c1
Sequence:CCGGGAGTGATGCCTGTCCTTAAATCTCGAGATTTAAGGACAGGCATCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001891.2-607s21c1
Sequence:CCGGCAACCAAGAACTTCTACTTAACTCGAGTTAAGTAGAAGTTCTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001891.2-877s21c1
Sequence:CCGGTTTGACTCATGAACTATTTACCTCGAGGTAAATAGTTCATGAGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks