EMAIL THIS PAGE TO A FRIEND

CSN3

casein kappa

58 Gene Product Result for
Synonyms: CSN10 CSNK KCA
UniProtKB ID: P07498, Q13575
Gene ID:
Mouse(12994) casein kappa
Rat(29188) casein kappa
Goat(100861231) casein kappa
sheep(443394) casein kappa
fruit fly(40308) COP9 complex homolog subunit 3
Horse(100033983) casein kappa
cow(281728) casein kappa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005212 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005212 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005212 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007786 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007786 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007786 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005212 Rosetta Predictions human pricing
NM_031562 Rosetta Predictions rat pricing
NM_007786 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094675 predicted 201
2 SASI_Hs02_00339186 predicted 344
3 SASI_Hs02_00339187 predicted 448
4 SASI_Hs02_00339188 predicted 379
5 SASI_Hs01_00094677 predicted 319
6 SASI_Hs01_00094678 predicted 270
7 SASI_Hs02_00339189 predicted 228
8 SASI_Hs01_00094679 predicted 457
9 SASI_Hs01_00094680 predicted 577
10 SASI_Hs01_00094683 predicted 568
11 SASI_Hs01_00094674 predicted 205
12 SASI_Hs01_00094676 predicted 215
13 SASI_Hs01_00094681 predicted 241
14 SASI_Hs01_00094682 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031562 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101203 predicted 203
2 SASI_Rn01_00101204 predicted 266
3 SASI_Rn01_00101205 predicted 247
4 SASI_Rn01_00101206 predicted 216
5 SASI_Rn01_00101207 predicted 442
6 SASI_Rn01_00101208 predicted 254
7 SASI_Rn01_00101209 predicted 358
8 SASI_Rn01_00101211 predicted 194
9 SASI_Rn01_00101212 predicted 312
10 SASI_Rn02_00264783 predicted 475
11 SASI_Rn01_00101210 predicted 249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007786 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312460 predicted 699
2 SASI_Mm01_00071805 predicted 288
3 SASI_Mm01_00071806 predicted 424
4 SASI_Mm02_00312461 predicted 204
5 SASI_Mm02_00312462 predicted 772
6 SASI_Mm01_00071810 predicted 275
7 SASI_Mm01_00071811 predicted 489
8 SASI_Mm01_00071812 predicted 518
9 SASI_Mm02_00312463 predicted 788
10 SASI_Mm01_00071814 predicted 726
11 SASI_Mm01_00071807 predicted 663
12 SASI_Mm01_00071808 predicted 846
13 SASI_Mm01_00071809 predicted 824
14 SASI_Mm01_00071813 predicted 777
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005212
CSN3 MISSION shRNA Bacterial Glycerol Stock
casein kappa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005212.2-389s21c1
Sequence:CCGGCCAAACCTGCATCCATCATTTCTCGAGAAATGATGGATGCAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005212.2-254s21c1
Sequence:CCGGAGACCAGCTATAGCAATTAATCTCGAGATTAATTGCTATAGCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005212.2-588s21c1
Sequence:CCGGTTACTCCACCTACGGCATAAACTCGAGTTTATGCCGTAGGTGGAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005212.1-661s1c1
Sequence:CCGGGCTGAAACCAAATTACTACTTCTCGAGAAGTAGTAATTTGGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005212.1-300s1c1
Sequence:CCGGGCCTCGCACATATTATGCAAACTCGAGTTTGCATAATATGTGCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005212.1-102s1c1
Sequence:CCGGCCTGGCATTAACCCTGCCTTTCTCGAGAAAGGCAGGGTTAATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005212.1-168s1c1
Sequence:CCGGGAATGATGAAAGACCATTCTACTCGAGTAGAATGGTCTTTCATCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005212.1-222s1c1
Sequence:CCGGTGTGCCAAATAGCTATCCTTACTCGAGTAAGGATAGCTATTTGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005212
CSN3 MISSION shRNA shRNA Plasmid DNA
casein kappa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005212.2-389s21c1
Sequence:CCGGCCAAACCTGCATCCATCATTTCTCGAGAAATGATGGATGCAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005212.2-254s21c1
Sequence:CCGGAGACCAGCTATAGCAATTAATCTCGAGATTAATTGCTATAGCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005212.2-588s21c1
Sequence:CCGGTTACTCCACCTACGGCATAAACTCGAGTTTATGCCGTAGGTGGAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005212.1-661s1c1
Sequence:CCGGGCTGAAACCAAATTACTACTTCTCGAGAAGTAGTAATTTGGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005212.1-300s1c1
Sequence:CCGGGCCTCGCACATATTATGCAAACTCGAGTTTGCATAATATGTGCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005212.1-102s1c1
Sequence:CCGGCCTGGCATTAACCCTGCCTTTCTCGAGAAAGGCAGGGTTAATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005212.1-168s1c1
Sequence:CCGGGAATGATGAAAGACCATTCTACTCGAGTAGAATGGTCTTTCATCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005212.1-222s1c1
Sequence:CCGGTGTGCCAAATAGCTATCCTTACTCGAGTAAGGATAGCTATTTGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005212
CSN3 MISSION shRNA Lentiviral Transduction Particles
casein kappa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005212.2-389s21c1
Sequence:CCGGCCAAACCTGCATCCATCATTTCTCGAGAAATGATGGATGCAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005212.2-254s21c1
Sequence:CCGGAGACCAGCTATAGCAATTAATCTCGAGATTAATTGCTATAGCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005212.2-588s21c1
Sequence:CCGGTTACTCCACCTACGGCATAAACTCGAGTTTATGCCGTAGGTGGAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005212.1-661s1c1
Sequence:CCGGGCTGAAACCAAATTACTACTTCTCGAGAAGTAGTAATTTGGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005212.1-300s1c1
Sequence:CCGGGCCTCGCACATATTATGCAAACTCGAGTTTGCATAATATGTGCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005212.1-102s1c1
Sequence:CCGGCCTGGCATTAACCCTGCCTTTCTCGAGAAAGGCAGGGTTAATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005212.1-168s1c1
Sequence:CCGGGAATGATGAAAGACCATTCTACTCGAGTAGAATGGTCTTTCATCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005212.1-222s1c1
Sequence:CCGGTGTGCCAAATAGCTATCCTTACTCGAGTAAGGATAGCTATTTGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007786
CSN3 MISSION shRNA Bacterial Glycerol Stock
casein kappa
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000120842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007786.1-607s1c1
Sequence:CCGGACAATAAAGGTCTGGAACCAACTCGAGTTGGTTCCAGACCTTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007786.1-153s1c1
Sequence:CCGGCGATGAGCAAAGAGTCCTGTACTCGAGTACAGGACTCTTTGCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007786.1-189s1c1
Sequence:CCGGCGTCCTGAACTTCAATCAATACTCGAGTATTGATTGAAGTTCAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007786
CSN3 MISSION shRNA shRNA Plasmid DNA
casein kappa
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000120842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007786.1-607s1c1
Sequence:CCGGACAATAAAGGTCTGGAACCAACTCGAGTTGGTTCCAGACCTTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007786.1-153s1c1
Sequence:CCGGCGATGAGCAAAGAGTCCTGTACTCGAGTACAGGACTCTTTGCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007786.1-189s1c1
Sequence:CCGGCGTCCTGAACTTCAATCAATACTCGAGTATTGATTGAAGTTCAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007786
CSN3 MISSION shRNA Lentiviral Transduction Particles
casein kappa
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000120842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007786.1-607s1c1
Sequence:CCGGACAATAAAGGTCTGGAACCAACTCGAGTTGGTTCCAGACCTTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007786.1-153s1c1
Sequence:CCGGCGATGAGCAAAGAGTCCTGTACTCGAGTACAGGACTCTTTGCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007786.1-189s1c1
Sequence:CCGGCGTCCTGAACTTCAATCAATACTCGAGTATTGATTGAAGTTCAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks