EMAIL THIS PAGE TO A FRIEND

CSNK1A1

casein kinase 1, alpha 1

158 Gene Product Result for
Synonyms: CK1 CK1a CKIa HLCDGP1 PRO2975
Gene ID:
Mouse(93687) casein kinase 1, alpha 1
Rat(113927) casein kinase 1, alpha 1
Zebrafish(192307) casein kinase 1, alpha 1
chicken(395924) casein kinase 1, alpha 1
domestic cat(101085602) casein kinase 1, alpha 1
cow(282684) casein kinase 1, alpha 1
Horse(100060556) casein kinase 1, alpha 1
dog(479331) casein kinase 1, alpha 1
sheep(101120241) casein kinase 1, alpha 1
Domestic Rabbit(100009227) casein kinase 1, alpha 1
Domestic Rabbit(100301533) casein kinase 1, alpha 1
domestic guinea pig(100724050) casein kinase 1, alpha 1
naked mole-rat(101715121) casein kinase 1, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500510 Anti-CKI-α antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4500509 Anti-CKI-α, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, western blot pricing
C3119 Anti-CSNK1A1 (323-337) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2702431 Anti-Csnk1a1 antibody produced in rabbit affinity isolated antibody zebrafish
pricing
SAB2100491 Anti-CSNK1A1 antibody produced in rabbit affinity isolated antibody bovine, human, rat, zebrafish, mouse, guinea pig, horse
western blot pricing
HPA045614 Anti-CSNK1A1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA051334 Anti-CSNK1A1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB1302247 ANTI-MOUSE CSNK1A1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
SAB4504301 Anti-phospho-Casein Kinase I α (pTyr321) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4504608 Anti-phospho-CK-1 α (pTyr294) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB5300121 Monoclonal Anti-CSNK1A1 antibody produced in mouse clone 3C10F7, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
PLA0229 Rabbit anti-CKI alpha Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, pig, chimpanzee, rhesus monkey, marmoset, rabbit, mouse, primate, gorilla, rat, bovine
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001892 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001892 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001892 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146087 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146087 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146087 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025105 siRNAs that have been validated in the lab human pricing
NM_001892 siRNAs that have been validated in the lab human pricing
NM_053615 Rosetta Predictions rat pricing
NM_146087 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025105 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165646 validated 1316
2 SASI_Hs01_00165647 predicted 1326
3 SASI_Hs01_00165648 predicted 1228
4 SASI_Hs02_00307370 predicted 1602
5 SASI_Hs01_00165649 predicted 1793
6 SASI_Hs01_00165651 predicted 1683
7 SASI_Hs02_00307371 predicted 1696
8 SASI_Hs01_00165652 predicted 1570
9 SASI_Hs01_00165653 predicted 1556
10 SASI_Hs01_00165655 predicted 1755
11 SASI_Hs01_00165650 predicted 1757
12 SASI_Hs01_00165654 predicted 1558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001892 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023240 validated 1237
2 SASI_Hs01_00023241 predicted 1233
3 SASI_Hs01_00023242 predicted 1140
4 SASI_Hs02_00332757 predicted 1518
5 SASI_Hs01_00023243 predicted 1713
6 SASI_Hs01_00023245 predicted 1596
7 SASI_Hs02_00332758 predicted 1609
8 SASI_Hs01_00023246 predicted 1495
9 SASI_Hs01_00023247 predicted 1481
10 SASI_Hs01_00023249 predicted 1676
11 SASI_Hs01_00023244 predicted 1676
12 SASI_Hs01_00023248 predicted 1476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053615 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098421 predicted 446
2 SASI_Rn02_00266318 predicted 711
3 SASI_Rn01_00098422 predicted 567
4 SASI_Rn01_00098423 predicted 666
5 SASI_Rn01_00098424 predicted 219
6 SASI_Rn01_00098425 predicted 432
7 SASI_Rn01_00098427 predicted 283
8 SASI_Rn01_00098428 predicted 285
9 SASI_Rn01_00098429 predicted 711
10 SASI_Rn02_00266319 predicted 438
11 SASI_Rn01_00098426 predicted 410
12 SASI_Rn01_00098430 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146087 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119945 predicted 489
2 SASI_Mm01_00119946 predicted 612
3 SASI_Mm01_00119947 predicted 659
4 SASI_Mm01_00119948 predicted 926
5 SASI_Mm01_00119949 predicted 1043
6 SASI_Mm01_00119950 predicted 600
7 SASI_Mm01_00119951 predicted 891
8 SASI_Mm01_00119952 predicted 1033
9 SASI_Mm01_00119953 predicted 765
10 SASI_Mm01_00119954 predicted 773
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001892
VALIDATED
CSNK1A1 MISSION shRNA Bacterial Glycerol Stock
casein kinase 1, alpha 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001892.4-2669s1c1
Sequence:CCGGGACTAGCAGCTGGACTGATTTCTCGAGAAATCAGTCCAGCTGCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001892.4-2097s1c1
Sequence:CCGGGCATCTAAAGTGAAGACTTAACTCGAGTTAAGTCTTCACTTTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001892.4-662s1c1
Sequence:CCGGGCAAGCTCTATAAGATTCTTCCTCGAGGAAGAATCTTATAGAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001892.4-2397s1c1
Sequence:CCGGCCTTGCTGACTCACTATTAAACTCGAGTTTAATAGTGAGTCAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001892.4-730s1c1
Sequence:CCGGGACTACAATGTACTAGTCATGCTCGAGCATGACTAGTACATTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001892.4-898s1c1
Sequence:CCGGGATAACTTCCTAATGGGTATTCTCGAGAATACCCATTAGGAAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001892.4-1894s1c1
Sequence:CCGGGCCACAGTTGTGATGGTTGTTCTCGAGAACAACCATCACAACTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001892.4-1034s1c1
Sequence:CCGGCCCGATATGCTAGCATCAATGCTCGAGCATTGATGCTAGCATATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_001892.3-1721s1c1
Sequence:CCGGGCCTGCTTAATTGTGCTAGAACTCGAGTTCTAGCACAATTAAGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001892.3-890s1c1
Sequence:CCGGGCAGAATTTGCGATGTACTTACTCGAGTAAGTACATCGCAAATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001892.3-1120s1c1
Sequence:CCGGCAAGAGTAACATGAAAGGTTTCTCGAGAAACCTTTCATGTTACTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001892.4-570s21c1
Sequence:CCGGCATCTATTTGGCGATCAACATCTCGAGATGTTGATCGCCAAATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001892.4-662s21c1
Sequence:CCGGGCAAGCTCTATAAGATTCTTCCTCGAGGAAGAATCTTATAGAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001892.4-1894s21c1
Sequence:CCGGGCCACAGTTGTGATGGTTGTTCTCGAGAACAACCATCACAACTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001892.4-1240s21c1
Sequence:CCGGGCAGAATTTGCGATGTACTTACTCGAGTAAGTACATCGCAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001892
VALIDATED
CSNK1A1 MISSION shRNA shRNA Plasmid DNA
casein kinase 1, alpha 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001892.4-2669s1c1
Sequence:CCGGGACTAGCAGCTGGACTGATTTCTCGAGAAATCAGTCCAGCTGCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001892.4-2097s1c1
Sequence:CCGGGCATCTAAAGTGAAGACTTAACTCGAGTTAAGTCTTCACTTTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001892.4-662s1c1
Sequence:CCGGGCAAGCTCTATAAGATTCTTCCTCGAGGAAGAATCTTATAGAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001892.4-2397s1c1
Sequence:CCGGCCTTGCTGACTCACTATTAAACTCGAGTTTAATAGTGAGTCAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001892.4-730s1c1
Sequence:CCGGGACTACAATGTACTAGTCATGCTCGAGCATGACTAGTACATTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001892.4-898s1c1
Sequence:CCGGGATAACTTCCTAATGGGTATTCTCGAGAATACCCATTAGGAAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001892.4-1894s1c1
Sequence:CCGGGCCACAGTTGTGATGGTTGTTCTCGAGAACAACCATCACAACTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001892.4-1034s1c1
Sequence:CCGGCCCGATATGCTAGCATCAATGCTCGAGCATTGATGCTAGCATATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_001892.3-1721s1c1
Sequence:CCGGGCCTGCTTAATTGTGCTAGAACTCGAGTTCTAGCACAATTAAGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001892.3-890s1c1
Sequence:CCGGGCAGAATTTGCGATGTACTTACTCGAGTAAGTACATCGCAAATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001892.3-1120s1c1
Sequence:CCGGCAAGAGTAACATGAAAGGTTTCTCGAGAAACCTTTCATGTTACTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001892.4-570s21c1
Sequence:CCGGCATCTATTTGGCGATCAACATCTCGAGATGTTGATCGCCAAATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001892.4-662s21c1
Sequence:CCGGGCAAGCTCTATAAGATTCTTCCTCGAGGAAGAATCTTATAGAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001892.4-1894s21c1
Sequence:CCGGGCCACAGTTGTGATGGTTGTTCTCGAGAACAACCATCACAACTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001892.4-1240s21c1
Sequence:CCGGGCAGAATTTGCGATGTACTTACTCGAGTAAGTACATCGCAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001892
VALIDATED
CSNK1A1 MISSION shRNA Lentiviral Transduction Particles
casein kinase 1, alpha 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001892.4-2669s1c1
Sequence:CCGGGACTAGCAGCTGGACTGATTTCTCGAGAAATCAGTCCAGCTGCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001892.4-2097s1c1
Sequence:CCGGGCATCTAAAGTGAAGACTTAACTCGAGTTAAGTCTTCACTTTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001892.4-662s1c1
Sequence:CCGGGCAAGCTCTATAAGATTCTTCCTCGAGGAAGAATCTTATAGAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001892.4-2397s1c1
Sequence:CCGGCCTTGCTGACTCACTATTAAACTCGAGTTTAATAGTGAGTCAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001892.4-730s1c1
Sequence:CCGGGACTACAATGTACTAGTCATGCTCGAGCATGACTAGTACATTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001892.4-898s1c1
Sequence:CCGGGATAACTTCCTAATGGGTATTCTCGAGAATACCCATTAGGAAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001892.4-1894s1c1
Sequence:CCGGGCCACAGTTGTGATGGTTGTTCTCGAGAACAACCATCACAACTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001892.4-1034s1c1
Sequence:CCGGCCCGATATGCTAGCATCAATGCTCGAGCATTGATGCTAGCATATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_001892.3-1721s1c1
Sequence:CCGGGCCTGCTTAATTGTGCTAGAACTCGAGTTCTAGCACAATTAAGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001892.3-890s1c1
Sequence:CCGGGCAGAATTTGCGATGTACTTACTCGAGTAAGTACATCGCAAATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001892.3-1120s1c1
Sequence:CCGGCAAGAGTAACATGAAAGGTTTCTCGAGAAACCTTTCATGTTACTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001892.4-570s21c1
Sequence:CCGGCATCTATTTGGCGATCAACATCTCGAGATGTTGATCGCCAAATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001892.4-662s21c1
Sequence:CCGGGCAAGCTCTATAAGATTCTTCCTCGAGGAAGAATCTTATAGAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001892.4-1894s21c1
Sequence:CCGGGCCACAGTTGTGATGGTTGTTCTCGAGAACAACCATCACAACTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001892.4-1240s21c1
Sequence:CCGGGCAGAATTTGCGATGTACTTACTCGAGTAAGTACATCGCAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146087
VALIDATED
CSNK1A1 MISSION shRNA Bacterial Glycerol Stock
casein kinase 1, alpha 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146087.1-340s1c1
Sequence:CCGGGCTGTACGAGAGCAAACTGTACTCGAGTACAGTTTGCTCTCGTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146087.1-1036s1c1
Sequence:CCGGCCACCAATATGACTACACATTCTCGAGAATGTGTAGTCATATTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146087.1-929s1c1
Sequence:CCGGGCAGAATTTGCCATGTACTTACTCGAGTAAGTACATGGCAAATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146087.1-196s1c1
Sequence:CCGGCGAATTTATCGTCGGTGGAAACTCGAGTTTCCACCGACGATAAATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146087.1-610s1c1
Sequence:CCGGGCGTCACTGTAATAAGTTATTCTCGAGAATAACTTATTACAGTGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146087.2-1276s21c1
Sequence:CCGGGAACTTCATTTCGGTATAAACCTCGAGGTTTATACCGAAATGAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146087.2-610s21c1
Sequence:CCGGGCGTCACTGTAATAAGTTATTCTCGAGAATAACTTATTACAGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146087.2-1036s21c1
Sequence:CCGGCCACCAATATGACTACACATTCTCGAGAATGTGTAGTCATATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146087.2-929s21c1
Sequence:CCGGGCAGAATTTGCCATGTACTTACTCGAGTAAGTACATGGCAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146087
VALIDATED
CSNK1A1 MISSION shRNA shRNA Plasmid DNA
casein kinase 1, alpha 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146087.1-340s1c1
Sequence:CCGGGCTGTACGAGAGCAAACTGTACTCGAGTACAGTTTGCTCTCGTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146087.1-1036s1c1
Sequence:CCGGCCACCAATATGACTACACATTCTCGAGAATGTGTAGTCATATTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146087.1-929s1c1
Sequence:CCGGGCAGAATTTGCCATGTACTTACTCGAGTAAGTACATGGCAAATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146087.1-196s1c1
Sequence:CCGGCGAATTTATCGTCGGTGGAAACTCGAGTTTCCACCGACGATAAATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146087.1-610s1c1
Sequence:CCGGGCGTCACTGTAATAAGTTATTCTCGAGAATAACTTATTACAGTGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146087.2-1276s21c1
Sequence:CCGGGAACTTCATTTCGGTATAAACCTCGAGGTTTATACCGAAATGAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146087.2-610s21c1
Sequence:CCGGGCGTCACTGTAATAAGTTATTCTCGAGAATAACTTATTACAGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146087.2-1036s21c1
Sequence:CCGGCCACCAATATGACTACACATTCTCGAGAATGTGTAGTCATATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146087.2-929s21c1
Sequence:CCGGGCAGAATTTGCCATGTACTTACTCGAGTAAGTACATGGCAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146087
VALIDATED
CSNK1A1 MISSION shRNA Lentiviral Transduction Particles
casein kinase 1, alpha 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146087.1-340s1c1
Sequence:CCGGGCTGTACGAGAGCAAACTGTACTCGAGTACAGTTTGCTCTCGTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146087.1-1036s1c1
Sequence:CCGGCCACCAATATGACTACACATTCTCGAGAATGTGTAGTCATATTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146087.1-929s1c1
Sequence:CCGGGCAGAATTTGCCATGTACTTACTCGAGTAAGTACATGGCAAATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146087.1-196s1c1
Sequence:CCGGCGAATTTATCGTCGGTGGAAACTCGAGTTTCCACCGACGATAAATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146087.1-610s1c1
Sequence:CCGGGCGTCACTGTAATAAGTTATTCTCGAGAATAACTTATTACAGTGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146087.2-1276s21c1
Sequence:CCGGGAACTTCATTTCGGTATAAACCTCGAGGTTTATACCGAAATGAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146087.2-610s21c1
Sequence:CCGGGCGTCACTGTAATAAGTTATTCTCGAGAATAACTTATTACAGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146087.2-1036s21c1
Sequence:CCGGCCACCAATATGACTACACATTCTCGAGAATGTGTAGTCATATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146087.2-929s21c1
Sequence:CCGGGCAGAATTTGCCATGTACTTACTCGAGTAAGTACATGGCAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks