EMAIL THIS PAGE TO A FRIEND

CSNK1A1L

casein kinase 1, alpha 1-like

80 Gene Product Result for
Synonyms: CK1
Species: Human CSNK1A1L(122011)
UniProtKB ID: Q8N752, Q5T2N2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145203 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145203 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145203 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145203 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145203 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176170 predicted 1596
2 SASI_Hs01_00176171 predicted 1445
3 SASI_Hs01_00176172 predicted 421
4 SASI_Hs01_00176173 predicted 851
5 SASI_Hs01_00176174 predicted 1645
6 SASI_Hs01_00176175 predicted 1406
7 SASI_Hs01_00176176 predicted 586
8 SASI_Hs01_00176177 predicted 576
9 SASI_Hs01_00176178 predicted 848
10 SASI_Hs01_00176179 predicted 1447
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145203
CSNK1A1L MISSION shRNA Bacterial Glycerol Stock
casein kinase 1, alpha 1-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145203.2-1603s1c1
Sequence:CCGGCCCAAAGTGTAGCCTCTGTAACTCGAGTTACAGAGGCTACACTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145203.2-588s1c1
Sequence:CCGGGAGAGCAAACTCTACACGATTCTCGAGAATCGTGTAGAGTTTGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145203.2-548s1c1
Sequence:CCGGGCTGGAATCTCAGAAGGTCAACTCGAGTTGACCTTCTGAGATTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197181    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145203.2-1994s1c1
Sequence:CCGGGCTTACCTGTGAAGACATAAGCTCGAGCTTATGTCTTCACAGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145203.2-776s1c1
Sequence:CCGGCAGAATTGAATACGTGCATACCTCGAGGTATGCACGTATTCAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145203.2-2059s1c1
Sequence:CCGGCTATATCATGTTCTCGGTATTCTCGAGAATACCGAGAACATGATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145203.2-764s1c1
Sequence:CCGGCCAGATGATCAGCAGAATTGACTCGAGTCAATTCTGCTGATCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145203.2-1713s1c1
Sequence:CCGGCACGAATTGGTGGAGACATTGCTCGAGCAATGTCTCCACCAATTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145203.2-812s1c1
Sequence:CCGGCCGAGACATTAAACCAGATAACTCGAGTTATCTGGTTTAATGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196806    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145203.2-1823s1c1
Sequence:CCGGGCAAAGGTTGTAAATGCTTATCTCGAGATAAGCATTTACAACCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145203
CSNK1A1L MISSION shRNA shRNA Plasmid DNA
casein kinase 1, alpha 1-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145203.2-1603s1c1
Sequence:CCGGCCCAAAGTGTAGCCTCTGTAACTCGAGTTACAGAGGCTACACTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145203.2-588s1c1
Sequence:CCGGGAGAGCAAACTCTACACGATTCTCGAGAATCGTGTAGAGTTTGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145203.2-548s1c1
Sequence:CCGGGCTGGAATCTCAGAAGGTCAACTCGAGTTGACCTTCTGAGATTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197181    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145203.2-1994s1c1
Sequence:CCGGGCTTACCTGTGAAGACATAAGCTCGAGCTTATGTCTTCACAGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145203.2-776s1c1
Sequence:CCGGCAGAATTGAATACGTGCATACCTCGAGGTATGCACGTATTCAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145203.2-2059s1c1
Sequence:CCGGCTATATCATGTTCTCGGTATTCTCGAGAATACCGAGAACATGATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145203.2-764s1c1
Sequence:CCGGCCAGATGATCAGCAGAATTGACTCGAGTCAATTCTGCTGATCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145203.2-1713s1c1
Sequence:CCGGCACGAATTGGTGGAGACATTGCTCGAGCAATGTCTCCACCAATTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145203.2-812s1c1
Sequence:CCGGCCGAGACATTAAACCAGATAACTCGAGTTATCTGGTTTAATGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196806    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145203.2-1823s1c1
Sequence:CCGGGCAAAGGTTGTAAATGCTTATCTCGAGATAAGCATTTACAACCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145203
CSNK1A1L MISSION shRNA Lentiviral Transduction Particles
casein kinase 1, alpha 1-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145203.2-1603s1c1
Sequence:CCGGCCCAAAGTGTAGCCTCTGTAACTCGAGTTACAGAGGCTACACTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145203.2-588s1c1
Sequence:CCGGGAGAGCAAACTCTACACGATTCTCGAGAATCGTGTAGAGTTTGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145203.2-548s1c1
Sequence:CCGGGCTGGAATCTCAGAAGGTCAACTCGAGTTGACCTTCTGAGATTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197181    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145203.2-1994s1c1
Sequence:CCGGGCTTACCTGTGAAGACATAAGCTCGAGCTTATGTCTTCACAGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145203.2-776s1c1
Sequence:CCGGCAGAATTGAATACGTGCATACCTCGAGGTATGCACGTATTCAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145203.2-2059s1c1
Sequence:CCGGCTATATCATGTTCTCGGTATTCTCGAGAATACCGAGAACATGATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145203.2-764s1c1
Sequence:CCGGCCAGATGATCAGCAGAATTGACTCGAGTCAATTCTGCTGATCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145203.2-1713s1c1
Sequence:CCGGCACGAATTGGTGGAGACATTGCTCGAGCAATGTCTCCACCAATTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145203.2-812s1c1
Sequence:CCGGCCGAGACATTAAACCAGATAACTCGAGTTATCTGGTTTAATGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196806    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145203.2-1823s1c1
Sequence:CCGGGCAAAGGTTGTAAATGCTTATCTCGAGATAAGCATTTACAACCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks