EMAIL THIS PAGE TO A FRIEND

CSNK1D

casein kinase 1, delta

138 Gene Product Result for
Synonyms: ASPS CKIdelta FASPS2 HCKID
UniProtKB ID: P48730, A2I2P2, Q96KZ6, Q9BTN5
Gene ID:
Human(1453) Summary: This gene is a member of the casein kinase I (CKI) gene family whose members have been implicated in the control of cytoplasmic and nuclear processes, including DNA replication and repair. The encoded protein is highly similar to the mouse and rat CK1 delta homologs. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(104318) casein kinase 1, delta
Rat(64462) casein kinase 1, delta
chicken(417378) casein kinase 1, delta
dog(475928) casein kinase 1, delta
domestic cat(101091915) casein kinase 1, delta
cow(523542) casein kinase 1, delta
cow(407122) casein kinase 1, delta
naked mole-rat(101701576) casein kinase 1, delta
domestic guinea pig(100715387) casein kinase 1, delta
sheep(100171396) casein kinase 1, delta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
I0658 IC 261 ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001893 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001893 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001893 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139062 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139062 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139062 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027874 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027874 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027874 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU087821 MISSION® esiRNA esiRNA targeting mouse Csnk1d (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001893 Rosetta Predictions human pricing
NM_139062 Rosetta Predictions human pricing
NM_139060 Rosetta Predictions rat pricing
NM_027874 Rosetta Predictions mouse pricing
NM_139059 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091883 predicted 421
2 SASI_Hs01_00091884 predicted 655
3 SASI_Hs01_00091885 predicted 1046
4 SASI_Hs01_00091886 predicted 319
5 SASI_Hs02_00332759 predicted 388
6 SASI_Hs01_00091887 predicted 891
7 SASI_Hs01_00091888 predicted 871
8 SASI_Hs01_00091889 predicted 858
9 SASI_Hs01_00091890 predicted 533
10 SASI_Hs02_00332760 predicted 651
11 SASI_Hs01_00091881 predicted 1247
12 SASI_Hs01_00091882 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139062 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040879 predicted 417
2 SASI_Hs01_00040880 predicted 652
3 SASI_Hs01_00040881 predicted 1049
4 SASI_Hs01_00040882 predicted 321
5 SASI_Hs02_00364117 predicted 392
6 SASI_Hs01_00040883 predicted 893
7 SASI_Hs01_00040884 predicted 871
8 SASI_Hs01_00040885 predicted 861
9 SASI_Hs01_00040886 predicted 539
10 SASI_Hs02_00364118 predicted 653
11 SASI_Hs01_00040877 predicted 1253
12 SASI_Hs01_00040878 predicted 974
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139060 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268424 predicted 1642
2 SASI_Rn01_00111449 predicted 648
3 SASI_Rn01_00111451 predicted 633
4 SASI_Rn01_00111452 predicted 1392
5 SASI_Rn01_00111453 predicted 1018
6 SASI_Rn02_00268425 predicted 1609
7 SASI_Rn01_00111454 predicted 998
8 SASI_Rn01_00111456 predicted 1046
9 SASI_Rn01_00111458 predicted 1250
10 SASI_Rn02_00268426 predicted 603
11 SASI_Rn01_00111450 predicted 642
12 SASI_Rn01_00111455 predicted 565
13 SASI_Rn01_00111457 predicted 437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027874 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185096 predicted 654
2 SASI_Mm01_00185097 predicted 649
3 SASI_Mm01_00185099 predicted 1053
4 SASI_Mm01_00185101 predicted 463
5 SASI_Mm02_00332835 predicted 664
6 SASI_Mm01_00185102 predicted 1260
7 SASI_Mm01_00185104 predicted 1247
8 SASI_Mm02_00332836 predicted 1261
9 SASI_Mm01_00185105 predicted 395
10 SASI_Mm02_00332837 predicted 1166
11 SASI_Mm01_00185098 predicted 1020
12 SASI_Mm01_00185100 predicted 422
13 SASI_Mm01_00185103 predicted 609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139059 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156446 predicted 655
2 SASI_Mm01_00156447 predicted 645
3 SASI_Mm01_00156449 predicted 1056
4 SASI_Mm01_00156451 predicted 464
5 SASI_Mm02_00339864 predicted 659
6 SASI_Mm01_00156452 predicted 1256
7 SASI_Mm01_00156454 predicted 1249
8 SASI_Mm02_00339865 predicted 1259
9 SASI_Mm01_00156455 predicted 403
10 SASI_Mm02_00339866 predicted 1171
11 SASI_Mm01_00156448 predicted 1021
12 SASI_Mm01_00156450 predicted 423
13 SASI_Mm01_00156453 predicted 616
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001893
VALIDATED
CSNK1D MISSION shRNA Bacterial Glycerol Stock
casein kinase 1, delta
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199409    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001893.3-1774s1c1
Sequence:CCGGCCACGTGAACTCGGTTGTAACCTCGAGGTTACAACCGAGTTCACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001893.3-813s1c1
Sequence:CCGGCCTATCGTGAGAACAAGAACCCTCGAGGGTTCTTGTTCTCACGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194725    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001893.3-1620s1c1
Sequence:CCGGCCAATGGCTTTACTAGTGACACTCGAGTGTCACTAGTAAAGCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001893.x-975s1c1
Sequence:CCGGCCAAGAGACAGAAATACGAAACTCGAGTTTCGTATTTCTGTCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001893.x-1027s1c1
Sequence:CCGGCGAAGTGTTGTGTAAAGGCTACTCGAGTAGCCTTTACACAACACTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001893.x-991s1c1
Sequence:CCGGCGAAAGGATTAGCGAGAAGAACTCGAGTTCTTCTCGCTAATCCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001893
VALIDATED
CSNK1D MISSION shRNA shRNA Plasmid DNA
casein kinase 1, delta
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199409    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001893.3-1774s1c1
Sequence:CCGGCCACGTGAACTCGGTTGTAACCTCGAGGTTACAACCGAGTTCACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001893.3-813s1c1
Sequence:CCGGCCTATCGTGAGAACAAGAACCCTCGAGGGTTCTTGTTCTCACGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194725    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001893.3-1620s1c1
Sequence:CCGGCCAATGGCTTTACTAGTGACACTCGAGTGTCACTAGTAAAGCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001893.x-975s1c1
Sequence:CCGGCCAAGAGACAGAAATACGAAACTCGAGTTTCGTATTTCTGTCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001893.x-1027s1c1
Sequence:CCGGCGAAGTGTTGTGTAAAGGCTACTCGAGTAGCCTTTACACAACACTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001893.x-991s1c1
Sequence:CCGGCGAAAGGATTAGCGAGAAGAACTCGAGTTCTTCTCGCTAATCCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001893
VALIDATED
CSNK1D MISSION shRNA Lentiviral Transduction Particles
casein kinase 1, delta
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199409    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001893.3-1774s1c1
Sequence:CCGGCCACGTGAACTCGGTTGTAACCTCGAGGTTACAACCGAGTTCACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001893.3-813s1c1
Sequence:CCGGCCTATCGTGAGAACAAGAACCCTCGAGGGTTCTTGTTCTCACGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194725    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001893.3-1620s1c1
Sequence:CCGGCCAATGGCTTTACTAGTGACACTCGAGTGTCACTAGTAAAGCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001893.x-975s1c1
Sequence:CCGGCCAAGAGACAGAAATACGAAACTCGAGTTTCGTATTTCTGTCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001893.x-1027s1c1
Sequence:CCGGCGAAGTGTTGTGTAAAGGCTACTCGAGTAGCCTTTACACAACACTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001893.x-991s1c1
Sequence:CCGGCGAAAGGATTAGCGAGAAGAACTCGAGTTCTTCTCGCTAATCCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139062
VALIDATED
CSNK1D MISSION shRNA Bacterial Glycerol Stock
casein kinase 1, delta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_139062.x-1501s1c1
Sequence:CCGGGTCCACCTCACAGAATAGCATCTCGAGATGCTATTCTGTGAGGTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_139062.x-975s1c1
Sequence:CCGGCCAAGAGACAGAAATACGAAACTCGAGTTTCGTATTTCTGTCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139062.x-1022s1c1
Sequence:CCGGCCCATCGAAGTGTTGTGTAAACTCGAGTTTACACAACACTTCGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139062.x-991s1c1
Sequence:CCGGCGAAAGGATTAGCGAGAAGAACTCGAGTTCTTCTCGCTAATCCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_139062.x-1027s1c1
Sequence:CCGGCGAAGTGTTGTGTAAAGGCTACTCGAGTAGCCTTTACACAACACTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139062.1-650s21c1
Sequence:CCGGATGATCAGTCGCATCGAATACCTCGAGGTATTCGATGCGACTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139062.1-991s21c1
Sequence:CCGGCGAAAGGATTAGCGAGAAGAACTCGAGTTCTTCTCGCTAATCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_139062.1-1622s21c1
Sequence:CCGGCCGATGAGAACTCTCCTTATTCTCGAGAATAAGGAGAGTTCTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_139062.1-1501s21c1
Sequence:CCGGGTCCACCTCACAGAATAGCATCTCGAGATGCTATTCTGTGAGGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_139062.1-975s21c1
Sequence:CCGGCCAAGAGACAGAAATACGAAACTCGAGTTTCGTATTTCTGTCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139062
VALIDATED
CSNK1D MISSION shRNA shRNA Plasmid DNA
casein kinase 1, delta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_139062.x-1501s1c1
Sequence:CCGGGTCCACCTCACAGAATAGCATCTCGAGATGCTATTCTGTGAGGTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_139062.x-975s1c1
Sequence:CCGGCCAAGAGACAGAAATACGAAACTCGAGTTTCGTATTTCTGTCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139062.x-1022s1c1
Sequence:CCGGCCCATCGAAGTGTTGTGTAAACTCGAGTTTACACAACACTTCGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139062.x-991s1c1
Sequence:CCGGCGAAAGGATTAGCGAGAAGAACTCGAGTTCTTCTCGCTAATCCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_139062.x-1027s1c1
Sequence:CCGGCGAAGTGTTGTGTAAAGGCTACTCGAGTAGCCTTTACACAACACTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139062.1-650s21c1
Sequence:CCGGATGATCAGTCGCATCGAATACCTCGAGGTATTCGATGCGACTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139062.1-991s21c1
Sequence:CCGGCGAAAGGATTAGCGAGAAGAACTCGAGTTCTTCTCGCTAATCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_139062.1-1622s21c1
Sequence:CCGGCCGATGAGAACTCTCCTTATTCTCGAGAATAAGGAGAGTTCTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_139062.1-1501s21c1
Sequence:CCGGGTCCACCTCACAGAATAGCATCTCGAGATGCTATTCTGTGAGGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_139062.1-975s21c1
Sequence:CCGGCCAAGAGACAGAAATACGAAACTCGAGTTTCGTATTTCTGTCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139062
VALIDATED
CSNK1D MISSION shRNA Lentiviral Transduction Particles
casein kinase 1, delta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_139062.x-1501s1c1
Sequence:CCGGGTCCACCTCACAGAATAGCATCTCGAGATGCTATTCTGTGAGGTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_139062.x-975s1c1
Sequence:CCGGCCAAGAGACAGAAATACGAAACTCGAGTTTCGTATTTCTGTCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139062.x-1022s1c1
Sequence:CCGGCCCATCGAAGTGTTGTGTAAACTCGAGTTTACACAACACTTCGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139062.x-991s1c1
Sequence:CCGGCGAAAGGATTAGCGAGAAGAACTCGAGTTCTTCTCGCTAATCCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_139062.x-1027s1c1
Sequence:CCGGCGAAGTGTTGTGTAAAGGCTACTCGAGTAGCCTTTACACAACACTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139062.1-650s21c1
Sequence:CCGGATGATCAGTCGCATCGAATACCTCGAGGTATTCGATGCGACTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139062.1-991s21c1
Sequence:CCGGCGAAAGGATTAGCGAGAAGAACTCGAGTTCTTCTCGCTAATCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_139062.1-1622s21c1
Sequence:CCGGCCGATGAGAACTCTCCTTATTCTCGAGAATAAGGAGAGTTCTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_139062.1-1501s21c1
Sequence:CCGGGTCCACCTCACAGAATAGCATCTCGAGATGCTATTCTGTGAGGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_139062.1-975s21c1
Sequence:CCGGCCAAGAGACAGAAATACGAAACTCGAGTTTCGTATTTCTGTCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027874
VALIDATED
CSNK1D MISSION shRNA Bacterial Glycerol Stock
casein kinase 1, delta
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027874.1-1062s1c1
Sequence:CCGGCCTGAATTTCTGCCGTTCCTTCTCGAGAAGGAACGGCAGAAATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027874.1-1234s1c1
Sequence:CCGGCGGGATCGAGAAGAACGATTACTCGAGTAATCGTTCTTCTCGATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027874.1-1031s1c1
Sequence:CCGGGCAAGGGCTATCCTTCTGAATCTCGAGATTCAGAAGGATAGCCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027874.1-637s1c1
Sequence:CCGGGACCAAATGATAAGTCGTATTCTCGAGAATACGACTTATCATTTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027874.1-1499s1c1
Sequence:CCGGCCTCACAGAATAGCATTCCTTCTCGAGAAGGAATGCTATTCTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027874.2-1682s21c1
Sequence:CCGGCTCTGTTACCAATGGCTTTACCTCGAGGTAAAGCCATTGGTAACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027874.2-1416s21c1
Sequence:CCGGCGAGAACGGAAAGTGAGTATGCTCGAGCATACTCACTTTCCGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027874.2-652s21c1
Sequence:CCGGACCAAATGATAAGTCGTATTGCTCGAGCAATACGACTTATCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027874.2-1250s21c1
Sequence:CCGGGGATCGAGAAGAACGATTAAGCTCGAGCTTAATCGTTCTTCTCGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027874.2-391s21c1
Sequence:CCGGTCTATCTCGGTACGGACATTGCTCGAGCAATGTCCGTACCGAGATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027874.2-1670s21c1
Sequence:CCGGATGGCTGATCTACTCTGTTACCTCGAGGTAACAGAGTAGATCAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027874.2-1064s21c1
Sequence:CCGGATTTGCCACATACCTGAATTTCTCGAGAAATTCAGGTATGTGGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027874.2-665s21c1
Sequence:CCGGTCGTATTGAGTACATTCATTCCTCGAGGAATGAATGTACTCAATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027874
VALIDATED
CSNK1D MISSION shRNA shRNA Plasmid DNA
casein kinase 1, delta
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027874.1-1062s1c1
Sequence:CCGGCCTGAATTTCTGCCGTTCCTTCTCGAGAAGGAACGGCAGAAATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027874.1-1234s1c1
Sequence:CCGGCGGGATCGAGAAGAACGATTACTCGAGTAATCGTTCTTCTCGATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027874.1-1031s1c1
Sequence:CCGGGCAAGGGCTATCCTTCTGAATCTCGAGATTCAGAAGGATAGCCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027874.1-637s1c1
Sequence:CCGGGACCAAATGATAAGTCGTATTCTCGAGAATACGACTTATCATTTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027874.1-1499s1c1
Sequence:CCGGCCTCACAGAATAGCATTCCTTCTCGAGAAGGAATGCTATTCTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027874.2-1682s21c1
Sequence:CCGGCTCTGTTACCAATGGCTTTACCTCGAGGTAAAGCCATTGGTAACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027874.2-1416s21c1
Sequence:CCGGCGAGAACGGAAAGTGAGTATGCTCGAGCATACTCACTTTCCGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027874.2-652s21c1
Sequence:CCGGACCAAATGATAAGTCGTATTGCTCGAGCAATACGACTTATCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027874.2-1250s21c1
Sequence:CCGGGGATCGAGAAGAACGATTAAGCTCGAGCTTAATCGTTCTTCTCGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027874.2-391s21c1
Sequence:CCGGTCTATCTCGGTACGGACATTGCTCGAGCAATGTCCGTACCGAGATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027874.2-1670s21c1
Sequence:CCGGATGGCTGATCTACTCTGTTACCTCGAGGTAACAGAGTAGATCAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027874.2-1064s21c1
Sequence:CCGGATTTGCCACATACCTGAATTTCTCGAGAAATTCAGGTATGTGGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027874.2-665s21c1
Sequence:CCGGTCGTATTGAGTACATTCATTCCTCGAGGAATGAATGTACTCAATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027874
VALIDATED
CSNK1D MISSION shRNA Lentiviral Transduction Particles
casein kinase 1, delta
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027874.1-1062s1c1
Sequence:CCGGCCTGAATTTCTGCCGTTCCTTCTCGAGAAGGAACGGCAGAAATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027874.1-1234s1c1
Sequence:CCGGCGGGATCGAGAAGAACGATTACTCGAGTAATCGTTCTTCTCGATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027874.1-1031s1c1
Sequence:CCGGGCAAGGGCTATCCTTCTGAATCTCGAGATTCAGAAGGATAGCCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027874.1-637s1c1
Sequence:CCGGGACCAAATGATAAGTCGTATTCTCGAGAATACGACTTATCATTTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027874.1-1499s1c1
Sequence:CCGGCCTCACAGAATAGCATTCCTTCTCGAGAAGGAATGCTATTCTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027874.2-1682s21c1
Sequence:CCGGCTCTGTTACCAATGGCTTTACCTCGAGGTAAAGCCATTGGTAACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027874.2-1416s21c1
Sequence:CCGGCGAGAACGGAAAGTGAGTATGCTCGAGCATACTCACTTTCCGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027874.2-652s21c1
Sequence:CCGGACCAAATGATAAGTCGTATTGCTCGAGCAATACGACTTATCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027874.2-1250s21c1
Sequence:CCGGGGATCGAGAAGAACGATTAAGCTCGAGCTTAATCGTTCTTCTCGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027874.2-391s21c1
Sequence:CCGGTCTATCTCGGTACGGACATTGCTCGAGCAATGTCCGTACCGAGATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027874.2-1670s21c1
Sequence:CCGGATGGCTGATCTACTCTGTTACCTCGAGGTAACAGAGTAGATCAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027874.2-1064s21c1
Sequence:CCGGATTTGCCACATACCTGAATTTCTCGAGAAATTCAGGTATGTGGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027874.2-665s21c1
Sequence:CCGGTCGTATTGAGTACATTCATTCCTCGAGGAATGAATGTACTCAATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks