EMAIL THIS PAGE TO A FRIEND

CSNK1E

casein kinase 1, epsilon

86 Gene Product Result for
Synonyms: CKIepsilon HCKIE
UniProtKB ID: P49674
Gene ID:
Human(1454) Summary: The protein encoded by this gene is a serine/threonine protein kinase and a member of the casein kinase I protein family, whose members have been implicated in the control of cytoplasmic and nuclear processes, including DNA replication and repair. The encoded protein is found in the cytoplasm as a monomer and can phosphorylate a variety of proteins, including itself. This protein has been shown to phosphorylate period, a circadian rhythm protein. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(27373) casein kinase 1, epsilon
Rat(58822) casein kinase 1, epsilon
Zebrafish(100006858) casein kinase 1, epsilon
chicken(378891) casein kinase 1, epsilon
dog(474510) casein kinase 1, epsilon
cow(768234) casein kinase 1, epsilon
domestic cat(101101321) casein kinase 1, epsilon
sheep(443240) casein kinase 1, epsilon
domestic guinea pig(100727500) casein kinase 1, epsilon
naked mole-rat(101708403) casein kinase 1, epsilon
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
I0658 IC 261 ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013767 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013767 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013767 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001894 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001894 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001894 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_152221 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152221 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152221 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001894 Rosetta Predictions human pricing
NM_152221 Rosetta Predictions human pricing
NM_031617 Rosetta Predictions rat pricing
NM_013767 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037959 predicted 759
2 SASI_Hs01_00037960 predicted 329
3 SASI_Hs01_00037961 predicted 849
4 SASI_Hs01_00037962 predicted 832
5 SASI_Hs01_00037964 predicted 902
6 SASI_Hs01_00037965 predicted 811
7 SASI_Hs01_00037966 predicted 831
8 SASI_Hs01_00037967 predicted 389
9 SASI_Hs01_00037968 predicted 491
10 SASI_Hs02_00332761 predicted 685
11 SASI_Hs01_00037963 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111724 predicted 915
2 SASI_Hs01_00111725 predicted 484
3 SASI_Hs01_00111726 predicted 990
4 SASI_Hs01_00111727 predicted 980
5 SASI_Hs01_00111729 predicted 1049
6 SASI_Hs01_00111730 predicted 967
7 SASI_Hs01_00111731 predicted 980
8 SASI_Hs01_00111732 predicted 537
9 SASI_Hs01_00111733 predicted 641
10 SASI_Hs02_00365709 predicted 836
11 SASI_Hs01_00111728 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031617 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264909 predicted 481
2 SASI_Rn01_00103161 predicted 697
3 SASI_Rn01_00103163 predicted 594
4 SASI_Rn02_00264910 predicted 294
5 SASI_Rn01_00103164 predicted 223
6 SASI_Rn01_00103166 predicted 888
7 SASI_Rn01_00103167 predicted 630
8 SASI_Rn01_00103168 predicted 413
9 SASI_Rn01_00103169 predicted 950
10 SASI_Rn02_00264911 predicted 275
11 SASI_Rn01_00103160 predicted 495
12 SASI_Rn01_00103162 predicted 780
13 SASI_Rn01_00103165 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013767 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322714 predicted 452
2 SASI_Mm01_00065859 predicted 979
3 SASI_Mm01_00065860 predicted 1201
4 SASI_Mm01_00065861 predicted 792
5 SASI_Mm02_00322715 predicted 356
6 SASI_Mm02_00322716 predicted 251
7 SASI_Mm01_00065862 predicted 1203
8 SASI_Mm01_00065863 predicted 719
9 SASI_Mm01_00065864 predicted 738
10 SASI_Mm01_00065866 predicted 814
11 SASI_Mm01_00065865 predicted 996
12 SASI_Mm01_00065867 predicted 908
13 SASI_Mm01_00065868 predicted 759
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013767
CSNK1E MISSION shRNA Bacterial Glycerol Stock
casein kinase 1, epsilon
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013767.6-1205s21c1
Sequence:CCGGCGCATCCAACAAACTGGCAATCTCGAGATTGCCAGTTTGTTGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013767.6-490s21c1
Sequence:CCGGCGAGTACATACACTCCAAGAACTCGAGTTCTTGGAGTGTATGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013767.6-880s21c1
Sequence:CCGGCGAGTTCTCAACATACCTCAACTCGAGTTGAGGTATGTTGAGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013767.6-617s21c1
Sequence:CCGGGCCCGCACACACCAGCATATTCTCGAGAATATGCTGGTGTGTGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013767.3-1154s1c1
Sequence:CCGGCGCATCCAACAAACTGGCAATCTCGAGATTGCCAGTTTGTTGGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013767.3-566s1c1
Sequence:CCGGGCCCGCACACACCAGCATATTCTCGAGAATATGCTGGTGTGTGCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013767.3-439s1c1
Sequence:CCGGCGAGTACATACACTCCAAGAACTCGAGTTCTTGGAGTGTATGTACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013767.3-829s1c1
Sequence:CCGGCGAGTTCTCAACATACCTCAACTCGAGTTGAGGTATGTTGAGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013767
CSNK1E MISSION shRNA shRNA Plasmid DNA
casein kinase 1, epsilon
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013767.6-1205s21c1
Sequence:CCGGCGCATCCAACAAACTGGCAATCTCGAGATTGCCAGTTTGTTGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013767.6-490s21c1
Sequence:CCGGCGAGTACATACACTCCAAGAACTCGAGTTCTTGGAGTGTATGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013767.6-880s21c1
Sequence:CCGGCGAGTTCTCAACATACCTCAACTCGAGTTGAGGTATGTTGAGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013767.6-617s21c1
Sequence:CCGGGCCCGCACACACCAGCATATTCTCGAGAATATGCTGGTGTGTGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013767.3-1154s1c1
Sequence:CCGGCGCATCCAACAAACTGGCAATCTCGAGATTGCCAGTTTGTTGGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013767.3-566s1c1
Sequence:CCGGGCCCGCACACACCAGCATATTCTCGAGAATATGCTGGTGTGTGCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013767.3-439s1c1
Sequence:CCGGCGAGTACATACACTCCAAGAACTCGAGTTCTTGGAGTGTATGTACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013767.3-829s1c1
Sequence:CCGGCGAGTTCTCAACATACCTCAACTCGAGTTGAGGTATGTTGAGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013767
CSNK1E MISSION shRNA Lentiviral Transduction Particles
casein kinase 1, epsilon
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013767.6-1205s21c1
Sequence:CCGGCGCATCCAACAAACTGGCAATCTCGAGATTGCCAGTTTGTTGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013767.6-490s21c1
Sequence:CCGGCGAGTACATACACTCCAAGAACTCGAGTTCTTGGAGTGTATGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013767.6-880s21c1
Sequence:CCGGCGAGTTCTCAACATACCTCAACTCGAGTTGAGGTATGTTGAGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013767.6-617s21c1
Sequence:CCGGGCCCGCACACACCAGCATATTCTCGAGAATATGCTGGTGTGTGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013767.3-1154s1c1
Sequence:CCGGCGCATCCAACAAACTGGCAATCTCGAGATTGCCAGTTTGTTGGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013767.3-566s1c1
Sequence:CCGGGCCCGCACACACCAGCATATTCTCGAGAATATGCTGGTGTGTGCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013767.3-439s1c1
Sequence:CCGGCGAGTACATACACTCCAAGAACTCGAGTTCTTGGAGTGTATGTACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013767.3-829s1c1
Sequence:CCGGCGAGTTCTCAACATACCTCAACTCGAGTTGAGGTATGTTGAGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001894
VALIDATED
CSNK1E MISSION shRNA Bacterial Glycerol Stock
casein kinase 1, epsilon
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001894.x-641s1c1
Sequence:CCGGCCCGCTACGCTTCCATCAACACTCGAGTGTTGATGGAAGCGTAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.x-1380s1c1
Sequence:CCGGCCAGTGTTTGCTTAGTGTCTTCTCGAGAAGACACTAAGCAAACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.x-794s1c1
Sequence:CCGGTCAGCGAGAAGAAGATGTCAACTCGAGTTGACATCTTCTTCTCGCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001894.x-1340s1c1
Sequence:CCGGCATTTGACCATCTCGGGAAGTCTCGAGACTTCCCGAGATGGTCAAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.x-909s1c1
Sequence:CCGGCTCTTACCTACGTCAGCTCTTCTCGAGAAGAGCTGACGTAGGTAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001894.x-915s1c1
Sequence:CCGGCCTACGTCAGCTCTTCCGCAACTCGAGTTGCGGAAGAGCTGACGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.x-839s1c1
Sequence:CCGGGCTATCCCTCCGAATTCTCAACTCGAGTTGAGAATTCGGAGGGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.x-462s1c1
Sequence:CCGGGTATATCCACTCCAAGAACTTCTCGAGAAGTTCTTGGAGTGGATATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.4-217s1c1
Sequence:CCGGGCCATCAAGCTGGAGTGTGTGCTCGAGCACACACTCCAGCTTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001894.4-225s1c1
Sequence:CCGGGCTGGAGTGTGTGAAGACAAACTCGAGTTTGTCTTCACACACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195280    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001894.4-2238s1c1
Sequence:CCGGCATCTGGCTCTGAGTTATAAACTCGAGTTTATAACTCAGAGCCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.4-2069s1c1
Sequence:CCGGCCTGTGTCTACTAACAAGGACCTCGAGGTCCTTGTTAGTAGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.4-1389s1c1
Sequence:CCGGGCTTAGTGTCTTCACTGTATTCTCGAGAATACAGTGAAGACACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.4-159s1c1
Sequence:CCGGGAGCGGGTCCTTCGGAGATATCTCGAGATATCTCCGAAGGACCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001894
VALIDATED
CSNK1E MISSION shRNA shRNA Plasmid DNA
casein kinase 1, epsilon
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001894.x-641s1c1
Sequence:CCGGCCCGCTACGCTTCCATCAACACTCGAGTGTTGATGGAAGCGTAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.x-1380s1c1
Sequence:CCGGCCAGTGTTTGCTTAGTGTCTTCTCGAGAAGACACTAAGCAAACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.x-794s1c1
Sequence:CCGGTCAGCGAGAAGAAGATGTCAACTCGAGTTGACATCTTCTTCTCGCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001894.x-1340s1c1
Sequence:CCGGCATTTGACCATCTCGGGAAGTCTCGAGACTTCCCGAGATGGTCAAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.x-909s1c1
Sequence:CCGGCTCTTACCTACGTCAGCTCTTCTCGAGAAGAGCTGACGTAGGTAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001894.x-915s1c1
Sequence:CCGGCCTACGTCAGCTCTTCCGCAACTCGAGTTGCGGAAGAGCTGACGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.x-839s1c1
Sequence:CCGGGCTATCCCTCCGAATTCTCAACTCGAGTTGAGAATTCGGAGGGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.x-462s1c1
Sequence:CCGGGTATATCCACTCCAAGAACTTCTCGAGAAGTTCTTGGAGTGGATATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.4-217s1c1
Sequence:CCGGGCCATCAAGCTGGAGTGTGTGCTCGAGCACACACTCCAGCTTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001894.4-225s1c1
Sequence:CCGGGCTGGAGTGTGTGAAGACAAACTCGAGTTTGTCTTCACACACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195280    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001894.4-2238s1c1
Sequence:CCGGCATCTGGCTCTGAGTTATAAACTCGAGTTTATAACTCAGAGCCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.4-2069s1c1
Sequence:CCGGCCTGTGTCTACTAACAAGGACCTCGAGGTCCTTGTTAGTAGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.4-1389s1c1
Sequence:CCGGGCTTAGTGTCTTCACTGTATTCTCGAGAATACAGTGAAGACACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.4-159s1c1
Sequence:CCGGGAGCGGGTCCTTCGGAGATATCTCGAGATATCTCCGAAGGACCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001894
VALIDATED
CSNK1E MISSION shRNA Lentiviral Transduction Particles
casein kinase 1, epsilon
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001894.x-641s1c1
Sequence:CCGGCCCGCTACGCTTCCATCAACACTCGAGTGTTGATGGAAGCGTAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.x-1380s1c1
Sequence:CCGGCCAGTGTTTGCTTAGTGTCTTCTCGAGAAGACACTAAGCAAACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.x-794s1c1
Sequence:CCGGTCAGCGAGAAGAAGATGTCAACTCGAGTTGACATCTTCTTCTCGCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001894.x-1340s1c1
Sequence:CCGGCATTTGACCATCTCGGGAAGTCTCGAGACTTCCCGAGATGGTCAAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.x-909s1c1
Sequence:CCGGCTCTTACCTACGTCAGCTCTTCTCGAGAAGAGCTGACGTAGGTAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001894.x-915s1c1
Sequence:CCGGCCTACGTCAGCTCTTCCGCAACTCGAGTTGCGGAAGAGCTGACGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.x-839s1c1
Sequence:CCGGGCTATCCCTCCGAATTCTCAACTCGAGTTGAGAATTCGGAGGGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.x-462s1c1
Sequence:CCGGGTATATCCACTCCAAGAACTTCTCGAGAAGTTCTTGGAGTGGATATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.4-217s1c1
Sequence:CCGGGCCATCAAGCTGGAGTGTGTGCTCGAGCACACACTCCAGCTTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001894.4-225s1c1
Sequence:CCGGGCTGGAGTGTGTGAAGACAAACTCGAGTTTGTCTTCACACACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195280    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001894.4-2238s1c1
Sequence:CCGGCATCTGGCTCTGAGTTATAAACTCGAGTTTATAACTCAGAGCCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.4-2069s1c1
Sequence:CCGGCCTGTGTCTACTAACAAGGACCTCGAGGTCCTTGTTAGTAGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.4-1389s1c1
Sequence:CCGGGCTTAGTGTCTTCACTGTATTCTCGAGAATACAGTGAAGACACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001894.4-159s1c1
Sequence:CCGGGAGCGGGTCCTTCGGAGATATCTCGAGATATCTCCGAAGGACCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152221
VALIDATED
CSNK1E MISSION shRNA Bacterial Glycerol Stock
casein kinase 1, epsilon
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000001836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152221.x-895s1c1
Sequence:CCGGGCGCCAGAAGTATGAACGGATCTCGAGATCCGTTCATACTTCTGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_152221.x-1501s1c1
Sequence:CCGGCCAGTGTTTGCTTAGTGTCTTCTCGAGAAGACACTAAGCAAACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152221
VALIDATED
CSNK1E MISSION shRNA shRNA Plasmid DNA
casein kinase 1, epsilon
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000001836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152221.x-895s1c1
Sequence:CCGGGCGCCAGAAGTATGAACGGATCTCGAGATCCGTTCATACTTCTGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_152221.x-1501s1c1
Sequence:CCGGCCAGTGTTTGCTTAGTGTCTTCTCGAGAAGACACTAAGCAAACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152221
VALIDATED
CSNK1E MISSION shRNA Lentiviral Transduction Particles
casein kinase 1, epsilon
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000001836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152221.x-895s1c1
Sequence:CCGGGCGCCAGAAGTATGAACGGATCTCGAGATCCGTTCATACTTCTGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_152221.x-1501s1c1
Sequence:CCGGCCAGTGTTTGCTTAGTGTCTTCTCGAGAAGACACTAAGCAAACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks