EMAIL THIS PAGE TO A FRIEND

CSNK1G1

casein kinase 1, gamma 1

323 Gene Product Result for
Synonyms: CK1gamma1
UniProtKB ID: Q9HCP0, Q5JPH1, Q96AE9, Q9HCP1
Gene ID:
Human(53944) Summary: This gene encodes a member of the casein kinase I gene family. The encoded protein is a serine/threonine kinase that phosphorylates acidic proteins, and participates in pathways for cell growth. [provided by RefSeq, Nov 2011]
Mouse(214897) casein kinase 1, gamma 1
Rat(64086) casein kinase 1, gamma 1
naked mole-rat(101704848) casein kinase 1, gamma 1
domestic guinea pig(100728304) casein kinase 1, gamma 1
sheep(101109276) casein kinase 1, gamma 1
Zebrafish(494092) casein kinase 1, gamma 1
dog(478338) casein kinase 1, gamma 1
domestic cat(101087842) casein kinase 1, gamma 1
cow(527889) casein kinase 1, gamma 1
Horse(100053829) casein kinase 1, gamma 1
chicken(415328) casein kinase 1, gamma 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022048 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022048 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022048 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173185 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173185 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173185 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011664 Rosetta Predictions human pricing
NM_022048 Rosetta Predictions human pricing
NM_022288 Rosetta Predictions rat pricing
NM_173185 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225865 predicted 537
2 SASI_Hs01_00225866 predicted 1097
3 SASI_Hs01_00225867 predicted 1426
4 SASI_Hs01_00225868 predicted 1525
5 SASI_Hs01_00225869 predicted 1465
6 SASI_Hs01_00225870 predicted 1368
7 SASI_Hs01_00225871 predicted 922
8 SASI_Hs01_00225872 predicted 949
9 SASI_Hs01_00225873 predicted 436
10 SASI_Hs01_00225874 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022048 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243414 predicted 1162
2 SASI_Hs01_00243415 predicted 1495
3 SASI_Hs01_00243416 predicted 1593
4 SASI_Hs01_00243417 predicted 1533
5 SASI_Hs01_00243418 predicted 1436
6 SASI_Hs01_00243419 predicted 986
7 SASI_Hs01_00243420 predicted 1021
8 SASI_Hs01_00243421 predicted 495
9 SASI_Hs01_00243422 predicted 584
10 SASI_Hs02_00355401 predicted 937
11 SASI_Hs01_00243413 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022288 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103939 predicted 1215
2 SASI_Rn01_00103940 predicted 694
3 SASI_Rn01_00103941 predicted 760
4 SASI_Rn02_00263105 predicted 1121
5 SASI_Rn01_00103942 predicted 1162
6 SASI_Rn01_00103943 predicted 591
7 SASI_Rn01_00103945 predicted 523
8 SASI_Rn01_00103946 predicted 1220
9 SASI_Rn01_00103948 predicted 744
10 SASI_Rn02_00263106 predicted 1375
11 SASI_Rn01_00103944 predicted 950
12 SASI_Rn01_00103947 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173185 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174290 predicted 826
2 SASI_Mm01_00174291 predicted 1736
3 SASI_Mm01_00174292 predicted 986
4 SASI_Mm01_00174293 predicted 1353
5 SASI_Mm01_00174294 predicted 722
6 SASI_Mm01_00174295 predicted 891
7 SASI_Mm01_00174296 predicted 883
8 SASI_Mm01_00174298 predicted 1508
9 SASI_Mm01_00174299 predicted 436
10 SASI_Mm02_00345153 predicted 1356
11 SASI_Mm01_00174297 predicted 1452
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022048
VALIDATED
CSNK1G1 MISSION shRNA Bacterial Glycerol Stock
casein kinase 1, gamma 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_022048.3-954s1c1
Sequence:CCGGGAACCTCATTTACCGAGATGTCTCGAGACATCTCGGTAAATGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022048.3-4066s1c1
Sequence:CCGGGCTAACTTACTGTATAGAAAGCTCGAGCTTTCTATACAGTAAGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022048.3-2543s1c1
Sequence:CCGGGCATATTGTGTCTGGTTATATCTCGAGATATAACCAGACACAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022048.3-7446s1c1
Sequence:CCGGCTTTGCCCATTGTACTCTTAACTCGAGTTAAGAGTACAATGGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022048.3-1459s1c1
Sequence:CCGGGATTGGGTTGGGAGACCTATTCTCGAGAATAGGTCTCCCAACCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010606    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022048.x-1348s1c1
Sequence:CCGGTCAGAATAGTAGCAGATGTAACTCGAGTTACATCTGCTACTATTCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_022048.x-983s1c1
Sequence:CCGGGATGGCAACCTACCTTCGATACTCGAGTATCGAAGGTAGGTTGCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_022048.x-338s1c1
Sequence:CCGGAGCAATCAAACTGGAACCAATCTCGAGATTGGTTCCAGTTTGATTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_022048.x-524s1c1
Sequence:CCGGTGACCGAACATTTACTTTGAACTCGAGTTCAAAGTAAATGTTCGGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022048.x-1090s1c1
Sequence:CCGGCCTTTGACTATGCCTATGATTCTCGAGAATCATAGGCATAGTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022048
VALIDATED
CSNK1G1 MISSION shRNA shRNA Plasmid DNA
casein kinase 1, gamma 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_022048.3-954s1c1
Sequence:CCGGGAACCTCATTTACCGAGATGTCTCGAGACATCTCGGTAAATGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022048.3-4066s1c1
Sequence:CCGGGCTAACTTACTGTATAGAAAGCTCGAGCTTTCTATACAGTAAGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022048.3-2543s1c1
Sequence:CCGGGCATATTGTGTCTGGTTATATCTCGAGATATAACCAGACACAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022048.3-7446s1c1
Sequence:CCGGCTTTGCCCATTGTACTCTTAACTCGAGTTAAGAGTACAATGGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022048.3-1459s1c1
Sequence:CCGGGATTGGGTTGGGAGACCTATTCTCGAGAATAGGTCTCCCAACCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010606    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022048.x-1348s1c1
Sequence:CCGGTCAGAATAGTAGCAGATGTAACTCGAGTTACATCTGCTACTATTCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_022048.x-983s1c1
Sequence:CCGGGATGGCAACCTACCTTCGATACTCGAGTATCGAAGGTAGGTTGCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_022048.x-338s1c1
Sequence:CCGGAGCAATCAAACTGGAACCAATCTCGAGATTGGTTCCAGTTTGATTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_022048.x-524s1c1
Sequence:CCGGTGACCGAACATTTACTTTGAACTCGAGTTCAAAGTAAATGTTCGGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022048.x-1090s1c1
Sequence:CCGGCCTTTGACTATGCCTATGATTCTCGAGAATCATAGGCATAGTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022048
VALIDATED
CSNK1G1 MISSION shRNA Lentiviral Transduction Particles
casein kinase 1, gamma 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_022048.3-954s1c1
Sequence:CCGGGAACCTCATTTACCGAGATGTCTCGAGACATCTCGGTAAATGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022048.3-4066s1c1
Sequence:CCGGGCTAACTTACTGTATAGAAAGCTCGAGCTTTCTATACAGTAAGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022048.3-2543s1c1
Sequence:CCGGGCATATTGTGTCTGGTTATATCTCGAGATATAACCAGACACAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022048.3-7446s1c1
Sequence:CCGGCTTTGCCCATTGTACTCTTAACTCGAGTTAAGAGTACAATGGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022048.3-1459s1c1
Sequence:CCGGGATTGGGTTGGGAGACCTATTCTCGAGAATAGGTCTCCCAACCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010606    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022048.x-1348s1c1
Sequence:CCGGTCAGAATAGTAGCAGATGTAACTCGAGTTACATCTGCTACTATTCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_022048.x-983s1c1
Sequence:CCGGGATGGCAACCTACCTTCGATACTCGAGTATCGAAGGTAGGTTGCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_022048.x-338s1c1
Sequence:CCGGAGCAATCAAACTGGAACCAATCTCGAGATTGGTTCCAGTTTGATTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_022048.x-524s1c1
Sequence:CCGGTGACCGAACATTTACTTTGAACTCGAGTTCAAAGTAAATGTTCGGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022048.x-1090s1c1
Sequence:CCGGCCTTTGACTATGCCTATGATTCTCGAGAATCATAGGCATAGTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173185
VALIDATED
CSNK1G1 MISSION shRNA Bacterial Glycerol Stock
casein kinase 1, gamma 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173185.1-632s1c1
Sequence:CCGGGCCATTAAACTGGAACCAATACTCGAGTATTGGTTCCAGTTTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173185.1-618s1c1
Sequence:CCGGCCAATGAATATGTAGCCATTACTCGAGTAATGGCTACATATTCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173185.1-788s1c1
Sequence:CCGGCCTAGCTTGGAAGACTTGTTTCTCGAGAAACAAGTCTTCCAAGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173185.1-1500s1c1
Sequence:CCGGCATCACAACAACAGCCTCTTACTCGAGTAAGAGGCTGTTGTTGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173185.1-1288s1c1
Sequence:CCGGCCTTCGATATGTCAGGCGATTCTCGAGAATCGCCTGACATATCGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173185.2-787s21c1
Sequence:CCGGCCTAGCTTGGAAGACTTGTTTCTCGAGAAACAAGTCTTCCAAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173185.2-1287s21c1
Sequence:CCGGCCTTCGATATGTCAGGCGATTCTCGAGAATCGCCTGACATATCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173185.2-828s21c1
Sequence:CCGGTACTTTGAAGACGGTGTTAATCTCGAGATTAACACCGTCTTCAAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173185.2-2156s21c1
Sequence:CCGGCTCAACCCTCTCCAGCATAAACTCGAGTTTATGCTGGAGAGGGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173185.2-1177s21c1
Sequence:CCGGGGACTCAAGGCTGATACATTACTCGAGTAATGTATCAGCCTTGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173185
VALIDATED
CSNK1G1 MISSION shRNA shRNA Plasmid DNA
casein kinase 1, gamma 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173185.1-632s1c1
Sequence:CCGGGCCATTAAACTGGAACCAATACTCGAGTATTGGTTCCAGTTTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173185.1-618s1c1
Sequence:CCGGCCAATGAATATGTAGCCATTACTCGAGTAATGGCTACATATTCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173185.1-788s1c1
Sequence:CCGGCCTAGCTTGGAAGACTTGTTTCTCGAGAAACAAGTCTTCCAAGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173185.1-1500s1c1
Sequence:CCGGCATCACAACAACAGCCTCTTACTCGAGTAAGAGGCTGTTGTTGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173185.1-1288s1c1
Sequence:CCGGCCTTCGATATGTCAGGCGATTCTCGAGAATCGCCTGACATATCGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173185.2-787s21c1
Sequence:CCGGCCTAGCTTGGAAGACTTGTTTCTCGAGAAACAAGTCTTCCAAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173185.2-1287s21c1
Sequence:CCGGCCTTCGATATGTCAGGCGATTCTCGAGAATCGCCTGACATATCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173185.2-828s21c1
Sequence:CCGGTACTTTGAAGACGGTGTTAATCTCGAGATTAACACCGTCTTCAAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173185.2-2156s21c1
Sequence:CCGGCTCAACCCTCTCCAGCATAAACTCGAGTTTATGCTGGAGAGGGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173185.2-1177s21c1
Sequence:CCGGGGACTCAAGGCTGATACATTACTCGAGTAATGTATCAGCCTTGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173185
VALIDATED
CSNK1G1 MISSION shRNA Lentiviral Transduction Particles
casein kinase 1, gamma 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173185.1-632s1c1
Sequence:CCGGGCCATTAAACTGGAACCAATACTCGAGTATTGGTTCCAGTTTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173185.1-618s1c1
Sequence:CCGGCCAATGAATATGTAGCCATTACTCGAGTAATGGCTACATATTCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173185.1-788s1c1
Sequence:CCGGCCTAGCTTGGAAGACTTGTTTCTCGAGAAACAAGTCTTCCAAGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173185.1-1500s1c1
Sequence:CCGGCATCACAACAACAGCCTCTTACTCGAGTAAGAGGCTGTTGTTGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173185.1-1288s1c1
Sequence:CCGGCCTTCGATATGTCAGGCGATTCTCGAGAATCGCCTGACATATCGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173185.2-787s21c1
Sequence:CCGGCCTAGCTTGGAAGACTTGTTTCTCGAGAAACAAGTCTTCCAAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173185.2-1287s21c1
Sequence:CCGGCCTTCGATATGTCAGGCGATTCTCGAGAATCGCCTGACATATCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173185.2-828s21c1
Sequence:CCGGTACTTTGAAGACGGTGTTAATCTCGAGATTAACACCGTCTTCAAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173185.2-2156s21c1
Sequence:CCGGCTCAACCCTCTCCAGCATAAACTCGAGTTTATGCTGGAGAGGGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173185.2-1177s21c1
Sequence:CCGGGGACTCAAGGCTGATACATTACTCGAGTAATGTATCAGCCTTGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks