EMAIL THIS PAGE TO A FRIEND

CSNK1G2-AS1

CSNK1G2 antisense RNA 1

Synonyms: C19orf34
Species: Human CSNK1G2-AS1(255193)
UniProtKB ID: Q8NCQ2
Gene ID:
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1104049 Anti-C19orf34 (21-35) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152771 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152771 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152771 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020391 MISSION® esiRNA esiRNA human C19orf34 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152771 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152771 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197580 predicted 499
2 SASI_Hs01_00197581 predicted 499
3 SASI_Hs01_00197582 predicted 494
4 SASI_Hs01_00197583 predicted 478
5 SASI_Hs01_00197584 predicted 490
6 SASI_Hs01_00197585 predicted 489
7 SASI_Hs01_00197588 predicted 484
8 SASI_Hs01_00197589 predicted 521
9 SASI_Hs02_00366711 predicted 459
10 SASI_Hs01_00197586 predicted 493
11 SASI_Hs01_00197587 predicted 537
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152771
CSNK1G2-AS1 MISSION shRNA Bacterial Glycerol Stock
CSNK1G2 antisense RNA 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152771.1-651s1c1
Sequence:CCGGGATTATGCAAACGGAGGCAAGCTCGAGCTTGCCTCCGTTTGCATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152771.1-635s1c1
Sequence:CCGGCAAAGGCAAGAGTCCAGATTACTCGAGTAATCTGGACTCTTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152771.2-996s21c1
Sequence:CCGGGCTGCCCAGGTCTTCTATATCCTCGAGGATATAGAAGACCTGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152771.2-716s21c1
Sequence:CCGGGTGGACACATCTGCATCAAATCTCGAGATTTGATGCAGATGTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152771.2-504s21c1
Sequence:CCGGCGACTGTCATCACCACGAGAACTCGAGTTCTCGTGGTGATGACAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152771.2-640s21c1
Sequence:CCGGCAAGAGTCCAGATTATGCAAACTCGAGTTTGCATAATCTGGACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152771.2-689s21c1
Sequence:CCGGGCCTCAGACGCCATCAACAAACTCGAGTTTGTTGATGGCGTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152771
CSNK1G2-AS1 MISSION shRNA shRNA Plasmid DNA
CSNK1G2 antisense RNA 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152771.1-651s1c1
Sequence:CCGGGATTATGCAAACGGAGGCAAGCTCGAGCTTGCCTCCGTTTGCATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152771.1-635s1c1
Sequence:CCGGCAAAGGCAAGAGTCCAGATTACTCGAGTAATCTGGACTCTTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152771.2-996s21c1
Sequence:CCGGGCTGCCCAGGTCTTCTATATCCTCGAGGATATAGAAGACCTGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152771.2-716s21c1
Sequence:CCGGGTGGACACATCTGCATCAAATCTCGAGATTTGATGCAGATGTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152771.2-504s21c1
Sequence:CCGGCGACTGTCATCACCACGAGAACTCGAGTTCTCGTGGTGATGACAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152771.2-640s21c1
Sequence:CCGGCAAGAGTCCAGATTATGCAAACTCGAGTTTGCATAATCTGGACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152771.2-689s21c1
Sequence:CCGGGCCTCAGACGCCATCAACAAACTCGAGTTTGTTGATGGCGTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152771
CSNK1G2-AS1 MISSION shRNA Lentiviral Transduction Particles
CSNK1G2 antisense RNA 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152771.1-651s1c1
Sequence:CCGGGATTATGCAAACGGAGGCAAGCTCGAGCTTGCCTCCGTTTGCATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152771.1-635s1c1
Sequence:CCGGCAAAGGCAAGAGTCCAGATTACTCGAGTAATCTGGACTCTTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152771.2-996s21c1
Sequence:CCGGGCTGCCCAGGTCTTCTATATCCTCGAGGATATAGAAGACCTGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152771.2-716s21c1
Sequence:CCGGGTGGACACATCTGCATCAAATCTCGAGATTTGATGCAGATGTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152771.2-504s21c1
Sequence:CCGGCGACTGTCATCACCACGAGAACTCGAGTTCTCGTGGTGATGACAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152771.2-640s21c1
Sequence:CCGGCAAGAGTCCAGATTATGCAAACTCGAGTTTGCATAATCTGGACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152771.2-689s21c1
Sequence:CCGGGCCTCAGACGCCATCAACAAACTCGAGTTTGTTGATGGCGTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks