EMAIL THIS PAGE TO A FRIEND

CSNK1G2

casein kinase 1, gamma 2

97 Gene Product Result for
Synonyms: CK1g2
UniProtKB ID: P78368, B5BU42, O00704, Q8WUB1
Gene ID:
Mouse(103236) casein kinase 1, gamma 2
Rat(65278) casein kinase 1, gamma 2
cow(506060) casein kinase 1, gamma 2
domestic cat(101100186) casein kinase 1, gamma 2
dog(476751) casein kinase 1, gamma 2
sheep(101120239) casein kinase 1, gamma 2
domestic guinea pig(100733915) casein kinase 1, gamma 2
naked mole-rat(101719704) casein kinase 1, gamma 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500513 Anti-CKI-γ2, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
C3494 Anti-CSNK1G2 (12-25) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
C3619 Anti-CSNK1G2 (346-360) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1412434 ANTI-CSNK1G2 antibody produced in mouse clone 2E6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV51941 Anti-CSNK1G2 antibody produced in rabbit affinity isolated antibody , mouse, guinea pig, horse, zebrafish, rabbit, bovine, human, rat, canine
western blot pricing
HPA034868 Anti-CSNK1G2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA056572 Anti-CSNK1G2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
WH0001455M1 Monoclonal Anti-CSNK1G2 antibody produced in mouse clone 3F4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403705 Monoclonal Anti-CSNK1G2, (C-terminal) antibody produced in mouse clone 2F5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001319 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001319 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001319 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134002 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134002 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134002 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001319 Rosetta Predictions human pricing
NM_001033870 Rosetta Predictions rat pricing
NM_023102 Rosetta Predictions rat pricing
NM_134002 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115709 predicted 1234
2 SASI_Hs02_00331617 predicted 1359
3 SASI_Hs01_00115711 predicted 1340
4 SASI_Hs01_00115712 predicted 982
5 SASI_Hs01_00115714 predicted 1373
6 SASI_Hs01_00115715 predicted 1297
7 SASI_Hs01_00115716 predicted 1113
8 SASI_Hs02_00331618 predicted 1163
9 SASI_Hs01_00115717 predicted 1430
10 SASI_Hs01_00115718 predicted 923
11 SASI_Hs01_00115710 predicted 268
12 SASI_Hs01_00115713 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033870 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032154 predicted 530
2 SASI_Rn01_00032155 predicted 1236
3 SASI_Rn01_00032156 predicted 1274
4 SASI_Rn02_00203771 predicted 2057
5 SASI_Rn02_00203772 predicted 1173
6 SASI_Rn01_00032159 predicted 1417
7 SASI_Rn01_00032160 predicted 1327
8 SASI_Rn01_00032161 predicted 1338
9 SASI_Rn01_00032162 predicted 1368
10 SASI_Rn01_00032163 predicted 516
11 SASI_Rn01_00032157 predicted 2105
12 SASI_Rn01_00032158 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023102 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067941 predicted 532
2 SASI_Rn01_00067942 predicted 1238
3 SASI_Rn01_00067943 predicted 1269
4 SASI_Rn02_00263742 predicted 1925
5 SASI_Rn02_00263743 predicted 1168
6 SASI_Rn01_00067946 predicted 1412
7 SASI_Rn01_00067947 predicted 1323
8 SASI_Rn01_00067948 predicted 1341
9 SASI_Rn01_00067949 predicted 1364
10 SASI_Rn01_00067950 predicted 517
11 SASI_Rn01_00067944 predicted 1964
12 SASI_Rn01_00067945 predicted 1056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134002 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339144 predicted 566
2 SASI_Mm01_00123352 predicted 1806
3 SASI_Mm01_00123353 predicted 1254
4 SASI_Mm01_00123354 predicted 1917
5 SASI_Mm01_00123355 predicted 534
6 SASI_Mm01_00123357 predicted 476
7 SASI_Mm01_00123358 predicted 1393
8 SASI_Mm01_00123359 predicted 1301
9 SASI_Mm01_00123360 predicted 908
10 SASI_Mm01_00123361 predicted 1024
11 SASI_Mm01_00123356 predicted 543
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001319
VALIDATED
CSNK1G2 MISSION shRNA Bacterial Glycerol Stock
casein kinase 1, gamma 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001319.6-781s21c1
Sequence:CCGGGCACCTGGAGTACCGGTTCTACTCGAGTAGAACCGGTACTCCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001319.6-991s21c1
Sequence:CCGGGCACACCAAGAGCCTAATCTACTCGAGTAGATTAGGCTCTTGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001319.6-1169s21c1
Sequence:CCGGGCGCGCTACATGAGCATCAACCTCGAGGTTGATGCTCATGTAGCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001319.6-2002s21c1
Sequence:CCGGCCCTCCAAGAGCATTAACTATCTCGAGATAGTTAATGCTCTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001319.5-1532s1c1
Sequence:CCGGCCCTCCAAGAGCATTAACTATCTCGAGATAGTTAATGCTCTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001319.5-521s1c1
Sequence:CCGGGCACACCAAGAGCCTAATCTACTCGAGTAGATTAGGCTCTTGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001319.5-234s1c1
Sequence:CCGGCGCCTAGGAAAGAATCTCTATCTCGAGATAGAGATTCTTTCCTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001319.5-311s1c1
Sequence:CCGGGCACCTGGAGTACCGGTTCTACTCGAGTAGAACCGGTACTCCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001319.5-271s1c1
Sequence:CCGGCTATCAAATTGGAGCCGATCACTCGAGTGATCGGCTCCAATTTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001319.5-1690s1c1
Sequence:CCGGGCGTCATAAAGTCCAGCTTGTCTCGAGACAAGCTGGACTTTATGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001319.5-939s1c1
Sequence:CCGGCGCCTGGACTTCTTCGAGAAGCTCGAGCTTCTCGAAGAAGTCCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001319.5-699s1c1
Sequence:CCGGGCGCGCTACATGAGCATCAACCTCGAGGTTGATGCTCATGTAGCGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001319
VALIDATED
CSNK1G2 MISSION shRNA shRNA Plasmid DNA
casein kinase 1, gamma 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001319.6-781s21c1
Sequence:CCGGGCACCTGGAGTACCGGTTCTACTCGAGTAGAACCGGTACTCCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001319.6-991s21c1
Sequence:CCGGGCACACCAAGAGCCTAATCTACTCGAGTAGATTAGGCTCTTGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001319.6-1169s21c1
Sequence:CCGGGCGCGCTACATGAGCATCAACCTCGAGGTTGATGCTCATGTAGCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001319.6-2002s21c1
Sequence:CCGGCCCTCCAAGAGCATTAACTATCTCGAGATAGTTAATGCTCTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001319.5-1532s1c1
Sequence:CCGGCCCTCCAAGAGCATTAACTATCTCGAGATAGTTAATGCTCTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001319.5-521s1c1
Sequence:CCGGGCACACCAAGAGCCTAATCTACTCGAGTAGATTAGGCTCTTGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001319.5-234s1c1
Sequence:CCGGCGCCTAGGAAAGAATCTCTATCTCGAGATAGAGATTCTTTCCTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001319.5-311s1c1
Sequence:CCGGGCACCTGGAGTACCGGTTCTACTCGAGTAGAACCGGTACTCCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001319.5-271s1c1
Sequence:CCGGCTATCAAATTGGAGCCGATCACTCGAGTGATCGGCTCCAATTTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001319.5-1690s1c1
Sequence:CCGGGCGTCATAAAGTCCAGCTTGTCTCGAGACAAGCTGGACTTTATGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001319.5-939s1c1
Sequence:CCGGCGCCTGGACTTCTTCGAGAAGCTCGAGCTTCTCGAAGAAGTCCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001319.5-699s1c1
Sequence:CCGGGCGCGCTACATGAGCATCAACCTCGAGGTTGATGCTCATGTAGCGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001319
VALIDATED
CSNK1G2 MISSION shRNA Lentiviral Transduction Particles
casein kinase 1, gamma 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001319.6-781s21c1
Sequence:CCGGGCACCTGGAGTACCGGTTCTACTCGAGTAGAACCGGTACTCCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001319.6-991s21c1
Sequence:CCGGGCACACCAAGAGCCTAATCTACTCGAGTAGATTAGGCTCTTGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001319.6-1169s21c1
Sequence:CCGGGCGCGCTACATGAGCATCAACCTCGAGGTTGATGCTCATGTAGCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001319.6-2002s21c1
Sequence:CCGGCCCTCCAAGAGCATTAACTATCTCGAGATAGTTAATGCTCTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001319.5-1532s1c1
Sequence:CCGGCCCTCCAAGAGCATTAACTATCTCGAGATAGTTAATGCTCTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001319.5-521s1c1
Sequence:CCGGGCACACCAAGAGCCTAATCTACTCGAGTAGATTAGGCTCTTGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001319.5-234s1c1
Sequence:CCGGCGCCTAGGAAAGAATCTCTATCTCGAGATAGAGATTCTTTCCTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001319.5-311s1c1
Sequence:CCGGGCACCTGGAGTACCGGTTCTACTCGAGTAGAACCGGTACTCCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001319.5-271s1c1
Sequence:CCGGCTATCAAATTGGAGCCGATCACTCGAGTGATCGGCTCCAATTTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001319.5-1690s1c1
Sequence:CCGGGCGTCATAAAGTCCAGCTTGTCTCGAGACAAGCTGGACTTTATGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001319.5-939s1c1
Sequence:CCGGCGCCTGGACTTCTTCGAGAAGCTCGAGCTTCTCGAAGAAGTCCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001319.5-699s1c1
Sequence:CCGGGCGCGCTACATGAGCATCAACCTCGAGGTTGATGCTCATGTAGCGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134002
CSNK1G2 MISSION shRNA Bacterial Glycerol Stock
casein kinase 1, gamma 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134002.1-1395s1c1
Sequence:CCGGCTACGTGTTTGACTACGAGTACTCGAGTACTCGTAGTCAAACACGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134002.1-982s1c1
Sequence:CCGGTCCATCCACATCATCGACTTTCTCGAGAAAGTCGATGATGTGGATGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134002.1-1089s1c1
Sequence:CCGGCATGAGCATCAACACGCACTTCTCGAGAAGTGCGTGTTGATGCTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134002.1-535s1c1
Sequence:CCGGCGCCTAGGAAAGAATCTGTATCTCGAGATACAGATTCTTTCCTAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134002.1-1026s1c1
Sequence:CCGGCCCTGAGACTAAGAAGCACATCTCGAGATGTGCTTCTTAGTCTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134002
CSNK1G2 MISSION shRNA shRNA Plasmid DNA
casein kinase 1, gamma 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134002.1-1395s1c1
Sequence:CCGGCTACGTGTTTGACTACGAGTACTCGAGTACTCGTAGTCAAACACGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134002.1-982s1c1
Sequence:CCGGTCCATCCACATCATCGACTTTCTCGAGAAAGTCGATGATGTGGATGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134002.1-1089s1c1
Sequence:CCGGCATGAGCATCAACACGCACTTCTCGAGAAGTGCGTGTTGATGCTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134002.1-535s1c1
Sequence:CCGGCGCCTAGGAAAGAATCTGTATCTCGAGATACAGATTCTTTCCTAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134002.1-1026s1c1
Sequence:CCGGCCCTGAGACTAAGAAGCACATCTCGAGATGTGCTTCTTAGTCTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134002
CSNK1G2 MISSION shRNA Lentiviral Transduction Particles
casein kinase 1, gamma 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134002.1-1395s1c1
Sequence:CCGGCTACGTGTTTGACTACGAGTACTCGAGTACTCGTAGTCAAACACGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134002.1-982s1c1
Sequence:CCGGTCCATCCACATCATCGACTTTCTCGAGAAAGTCGATGATGTGGATGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134002.1-1089s1c1
Sequence:CCGGCATGAGCATCAACACGCACTTCTCGAGAAGTGCGTGTTGATGCTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134002.1-535s1c1
Sequence:CCGGCGCCTAGGAAAGAATCTGTATCTCGAGATACAGATTCTTTCCTAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134002.1-1026s1c1
Sequence:CCGGCCCTGAGACTAAGAAGCACATCTCGAGATGTGCTTCTTAGTCTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks