EMAIL THIS PAGE TO A FRIEND

CSNK1G3

casein kinase 1, gamma 3

254 Gene Product Result for
Synonyms: CKI-gamma 3 CSNK1G3L
Gene ID:
Human(1456) Summary: This gene encodes a member of a family of serine/threonine protein kinases that phosphorylate caseins and other acidic proteins. A related protein in the African clawed frog participates in the transmission of Wnt/beta-catenin signaling. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Mouse(70425) casein kinase 1, gamma 3
Rat(64823) casein kinase 1, gamma 3
domestic cat(101085017) casein kinase 1, gamma 3
Horse(100063886) casein kinase 1, gamma 3
cow(407190) casein kinase 1, gamma 3
dog(481481) casein kinase 1, gamma 3
naked mole-rat(101717564) casein kinase 1, gamma 3
domestic guinea pig(100733635) casein kinase 1, gamma 3
sheep(101109703) casein kinase 1, gamma 3
Domestic Rabbit(100338724) casein kinase 1, gamma 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152809 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_152809 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_152809 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004384 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004384 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004384 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134681 MISSION® esiRNA esiRNA human CSNK1G3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031812 Rosetta Predictions human pricing
NM_001044722 Rosetta Predictions human pricing
NM_001044723 Rosetta Predictions human pricing
NM_004384 Rosetta Predictions human pricing
NM_022855 Rosetta Predictions rat pricing
NM_152809 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307824 predicted 1178
2 SASI_Hs01_00086291 predicted 1335
3 SASI_Hs01_00086293 predicted 1349
4 SASI_Hs01_00086294 predicted 1474
5 SASI_Hs01_00086295 predicted 1393
6 SASI_Hs01_00086297 predicted 1400
7 SASI_Hs02_00307825 predicted 1301
8 SASI_Hs01_00086298 predicted 1389
9 SASI_Hs01_00086299 predicted 1569
10 SASI_Hs02_00307826 predicted 1183
11 SASI_Hs01_00086290 predicted 1078
12 SASI_Hs01_00086292 predicted 1445
13 SASI_Hs01_00086296 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311402 predicted 1173
2 SASI_Hs02_00311403 predicted 1343
3 SASI_Hs02_00311404 predicted 1348
4 SASI_Hs02_00311405 predicted 1476
5 SASI_Hs02_00311406 predicted 1391
6 SASI_Hs02_00311407 predicted 1404
7 SASI_Hs02_00311408 predicted 1304
8 SASI_Hs02_00311409 predicted 1391
9 SASI_Hs02_00311410 predicted 1563
10 SASI_Hs02_00311411 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311412 predicted 1169
2 SASI_Hs02_00311413 predicted 1337
3 SASI_Hs02_00311414 predicted 1352
4 SASI_Hs02_00311415 predicted 1480
5 SASI_Hs02_00311416 predicted 1397
6 SASI_Hs02_00311417 predicted 1407
7 SASI_Hs02_00311418 predicted 1302
8 SASI_Hs02_00311419 predicted 1393
9 SASI_Hs02_00311420 predicted 1561
10 SASI_Hs02_00311421 predicted 1185
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337481 predicted 1177
2 SASI_Hs01_00088635 predicted 1336
3 SASI_Hs01_00088637 predicted 1353
4 SASI_Hs01_00088638 predicted 1482
5 SASI_Hs01_00088639 predicted 1392
6 SASI_Hs01_00088641 predicted 1407
7 SASI_Hs02_00337482 predicted 1305
8 SASI_Hs01_00088642 predicted 1386
9 SASI_Hs01_00088643 predicted 1560
10 SASI_Hs02_00337483 predicted 1185
11 SASI_Hs01_00088634 predicted 1085
12 SASI_Hs01_00088636 predicted 1444
13 SASI_Hs01_00088640 predicted 1047
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022855 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263569 predicted 1451
2 SASI_Rn02_00263570 predicted 1662
3 SASI_Rn02_00263571 predicted 1728
4 SASI_Rn02_00263572 predicted 922
5 SASI_Rn02_00263573 predicted 1511
6 SASI_Rn02_00263574 predicted 1237
7 SASI_Rn02_00263575 predicted 878
8 SASI_Rn02_00263576 predicted 1898
9 SASI_Rn02_00263577 predicted 798
10 SASI_Rn02_00263578 predicted 1410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115050 predicted 1698
2 SASI_Mm02_00342810 predicted 1016
3 SASI_Mm02_00342811 predicted 890
4 SASI_Mm01_00115052 predicted 1633
5 SASI_Mm01_00115053 predicted 1655
6 SASI_Mm01_00115054 predicted 1880
7 SASI_Mm02_00342812 predicted 932
8 SASI_Mm01_00115055 predicted 1575
9 SASI_Mm01_00115056 predicted 1582
10 SASI_Mm02_00342813 predicted 1092
11 SASI_Mm01_00115051 predicted 267
12 SASI_Mm01_00115057 predicted 607
13 SASI_Mm01_00115058 predicted 649
14 SASI_Mm01_00115059 predicted 1099
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152809
VALIDATED
CSNK1G3 MISSION shRNA Bacterial Glycerol Stock
casein kinase 1, gamma 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152809.2-1873s21c1
Sequence:CCGGGACGGTCGAATGCACCCATTACTCGAGTAATGGGTGCATTCGACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152809.2-1012s21c1
Sequence:CCGGTAGGATCTGGAGATGGTATACCTCGAGGTATACCATCTCCAGATCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152809.2-931s21c1
Sequence:CCGGATGAATATGTGGCGATTAAACCTCGAGGTTTAATCGCCACATATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152809.1-835s1c1
Sequence:CCGGCCAGGTTGTAAGTTCTACAAACTCGAGTTTGTAGAACTTACAACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152809.1-280s1c1
Sequence:CCGGCCAGCAAGTCATTCATATCATCTCGAGATGATATGAATGACTTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152809.1-935s1c1
Sequence:CCGGGACGAGACAAACTGCCAGAAACTCGAGTTTCTGGCAGTTTGTCTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152809.1-208s1c1
Sequence:CCGGCCACTCAAAGAACTTGATATACTCGAGTATATCAAGTTCTTTGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152809.1-424s1c1
Sequence:CCGGGCAGAGTAGAAGAGATGATTTCTCGAGAAATCATCTCTTCTACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152809
VALIDATED
CSNK1G3 MISSION shRNA shRNA Plasmid DNA
casein kinase 1, gamma 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152809.2-1873s21c1
Sequence:CCGGGACGGTCGAATGCACCCATTACTCGAGTAATGGGTGCATTCGACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152809.2-1012s21c1
Sequence:CCGGTAGGATCTGGAGATGGTATACCTCGAGGTATACCATCTCCAGATCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152809.2-931s21c1
Sequence:CCGGATGAATATGTGGCGATTAAACCTCGAGGTTTAATCGCCACATATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152809.1-835s1c1
Sequence:CCGGCCAGGTTGTAAGTTCTACAAACTCGAGTTTGTAGAACTTACAACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152809.1-280s1c1
Sequence:CCGGCCAGCAAGTCATTCATATCATCTCGAGATGATATGAATGACTTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152809.1-935s1c1
Sequence:CCGGGACGAGACAAACTGCCAGAAACTCGAGTTTCTGGCAGTTTGTCTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152809.1-208s1c1
Sequence:CCGGCCACTCAAAGAACTTGATATACTCGAGTATATCAAGTTCTTTGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152809.1-424s1c1
Sequence:CCGGGCAGAGTAGAAGAGATGATTTCTCGAGAAATCATCTCTTCTACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152809
VALIDATED
CSNK1G3 MISSION shRNA Lentiviral Transduction Particles
casein kinase 1, gamma 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152809.2-1873s21c1
Sequence:CCGGGACGGTCGAATGCACCCATTACTCGAGTAATGGGTGCATTCGACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152809.2-1012s21c1
Sequence:CCGGTAGGATCTGGAGATGGTATACCTCGAGGTATACCATCTCCAGATCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152809.2-931s21c1
Sequence:CCGGATGAATATGTGGCGATTAAACCTCGAGGTTTAATCGCCACATATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152809.1-835s1c1
Sequence:CCGGCCAGGTTGTAAGTTCTACAAACTCGAGTTTGTAGAACTTACAACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152809.1-280s1c1
Sequence:CCGGCCAGCAAGTCATTCATATCATCTCGAGATGATATGAATGACTTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152809.1-935s1c1
Sequence:CCGGGACGAGACAAACTGCCAGAAACTCGAGTTTCTGGCAGTTTGTCTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152809.1-208s1c1
Sequence:CCGGCCACTCAAAGAACTTGATATACTCGAGTATATCAAGTTCTTTGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152809.1-424s1c1
Sequence:CCGGGCAGAGTAGAAGAGATGATTTCTCGAGAAATCATCTCTTCTACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004384
VALIDATED
CSNK1G3 MISSION shRNA Bacterial Glycerol Stock
casein kinase 1, gamma 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000355670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004384.3-1031s21c1
Sequence:CCGGTTTCGGCCCTTGTGGTAAATACTCGAGTATTTACCACAAGGGCCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004384.3-1557s21c1
Sequence:CCGGTTTCCAGAAATGGCAACATATCTCGAGATATGTTGCCATTTCTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004384.3-1356s1c1
Sequence:CCGGGCTAGATATATGAGCATAAACCTCGAGGTTTATGCTCATATATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004384.3-1976s1c1
Sequence:CCGGCCCTACTGAAGTAGAAGTGATCTCGAGATCACTTCTACTTCAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196403    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004384.3-2879s1c1
Sequence:CCGGGTGATGTATGTTGGAGTTATACTCGAGTATAACTCCAACATACATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004384.3-1569s1c1
Sequence:CCGGGCAACATATCTTCGTTATGTACTCGAGTACATAACGAAGATATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004384.x-560s1c1
Sequence:CCGGCCCAGCAAGTTATTCACATTACTCGAGTAATGTGAATAACTTGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004384.x-613s1c1
Sequence:CCGGCCGGAGACAAAGAAACACATACTCGAGTATGTGTTTCTTTGTCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004384.x-530s1c1
Sequence:CCGGACTTCTTAATAGGACGACCAACTCGAGTTGGTCGTCCTATTAAGAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004384.x-2281s1c1
Sequence:CCGGCACCGAAACTTACTGCTGAATCTCGAGATTCAGCAGTAAGTTTCGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004384.x-1260s1c1
Sequence:CCGGAGGACGTTCAAATGCACCCATCTCGAGATGGGTGCATTTGAACGTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004384
VALIDATED
CSNK1G3 MISSION shRNA shRNA Plasmid DNA
casein kinase 1, gamma 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000355670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004384.3-1031s21c1
Sequence:CCGGTTTCGGCCCTTGTGGTAAATACTCGAGTATTTACCACAAGGGCCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004384.3-1557s21c1
Sequence:CCGGTTTCCAGAAATGGCAACATATCTCGAGATATGTTGCCATTTCTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004384.3-1356s1c1
Sequence:CCGGGCTAGATATATGAGCATAAACCTCGAGGTTTATGCTCATATATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004384.3-1976s1c1
Sequence:CCGGCCCTACTGAAGTAGAAGTGATCTCGAGATCACTTCTACTTCAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196403    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004384.3-2879s1c1
Sequence:CCGGGTGATGTATGTTGGAGTTATACTCGAGTATAACTCCAACATACATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004384.3-1569s1c1
Sequence:CCGGGCAACATATCTTCGTTATGTACTCGAGTACATAACGAAGATATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004384.x-560s1c1
Sequence:CCGGCCCAGCAAGTTATTCACATTACTCGAGTAATGTGAATAACTTGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004384.x-613s1c1
Sequence:CCGGCCGGAGACAAAGAAACACATACTCGAGTATGTGTTTCTTTGTCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004384.x-530s1c1
Sequence:CCGGACTTCTTAATAGGACGACCAACTCGAGTTGGTCGTCCTATTAAGAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004384.x-2281s1c1
Sequence:CCGGCACCGAAACTTACTGCTGAATCTCGAGATTCAGCAGTAAGTTTCGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004384.x-1260s1c1
Sequence:CCGGAGGACGTTCAAATGCACCCATCTCGAGATGGGTGCATTTGAACGTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004384
VALIDATED
CSNK1G3 MISSION shRNA Lentiviral Transduction Particles
casein kinase 1, gamma 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000355670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004384.3-1031s21c1
Sequence:CCGGTTTCGGCCCTTGTGGTAAATACTCGAGTATTTACCACAAGGGCCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004384.3-1557s21c1
Sequence:CCGGTTTCCAGAAATGGCAACATATCTCGAGATATGTTGCCATTTCTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004384.3-1356s1c1
Sequence:CCGGGCTAGATATATGAGCATAAACCTCGAGGTTTATGCTCATATATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004384.3-1976s1c1
Sequence:CCGGCCCTACTGAAGTAGAAGTGATCTCGAGATCACTTCTACTTCAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196403    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004384.3-2879s1c1
Sequence:CCGGGTGATGTATGTTGGAGTTATACTCGAGTATAACTCCAACATACATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004384.3-1569s1c1
Sequence:CCGGGCAACATATCTTCGTTATGTACTCGAGTACATAACGAAGATATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004384.x-560s1c1
Sequence:CCGGCCCAGCAAGTTATTCACATTACTCGAGTAATGTGAATAACTTGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004384.x-613s1c1
Sequence:CCGGCCGGAGACAAAGAAACACATACTCGAGTATGTGTTTCTTTGTCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004384.x-530s1c1
Sequence:CCGGACTTCTTAATAGGACGACCAACTCGAGTTGGTCGTCCTATTAAGAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004384.x-2281s1c1
Sequence:CCGGCACCGAAACTTACTGCTGAATCTCGAGATTCAGCAGTAAGTTTCGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004384.x-1260s1c1
Sequence:CCGGAGGACGTTCAAATGCACCCATCTCGAGATGGGTGCATTTGAACGTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks