EMAIL THIS PAGE TO A FRIEND

CSNK2A2

casein kinase 2, alpha prime polypeptide

173 Gene Product Result for
Synonyms: CK2A2 CSNK2A1
UniProtKB ID: P19784
Gene ID:
Mouse(13000) casein kinase 2, alpha prime polypeptide
Rat(307641) casein kinase 2, alpha prime polypeptide
sheep(101122459) casein kinase 2, alpha prime polypeptide
naked mole-rat(101717615) casein kinase 2, alpha prime polypeptide
domestic guinea pig(100719884) casein kinase 2, alpha prime polypeptide
chicken(415626) casein kinase 2, alpha prime polypeptide
cow(282420) casein kinase 2, alpha prime polypeptide
domestic cat(101093065) casein kinase 2, alpha prime polypeptide
dog(478108) casein kinase 2, alpha prime polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108632 Anti-CSNK2A2 affinity isolated antibody human, yeast, guinea pig, mouse, bovine, pig, rat, horse, mouse, rabbit
western blot pricing
C6373 Anti-CSNK2A2 (276-290) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
C6248 Anti-CSNK2A2 (31-45) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV53595 Anti-CSNK2A2 (AB1) antibody produced in rabbit affinity isolated antibody , horse, guinea pig, human, bovine, rabbit, mouse, rat
western blot pricing
AV53596 Anti-CSNK2A2 (AB2) antibody produced in rabbit affinity isolated antibody bovine, guinea pig, horse, rat, human, rabbit, mouse
western blot pricing
SAB1410253 Anti-CSNK2A2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA077719 Anti-CSNK2A2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB1302602 ANTI-MOUSE CSNK2A2 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
WH0001459M1 Monoclonal Anti-CSNK2A2 antibody produced in mouse clone 4F2, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1403706 Monoclonal Anti-CSNK2A2, (N-terminal) antibody produced in mouse clone 1E8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Substrate

Product # Description Species Add to Cart
 
A2793 Arg-Arg-Arg-Glu-Glu-Glu-Thr-Glu-Glu-Glu lyophilized powder human, mouse, rat pricing
C2460 Casein Kinase II substrate ≥97% (HPLC) human, mouse, rat pricing

Kits

Product # Description Species Add to Cart
 
CS0610 Casein Kinase II Assay Kit sufficient for 70 reactions human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001896 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001896 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001896 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009974 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009974 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009974 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001896 Rosetta Predictions human pricing
NM_001107409 Rosetta Predictions rat pricing
NM_009974 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087709 predicted 400
2 SASI_Hs01_00087710 predicted 528
3 SASI_Hs01_00087711 predicted 1026
4 SASI_Hs01_00087712 predicted 410
5 SASI_Hs01_00087713 predicted 554
6 SASI_Hs01_00087714 predicted 1263
7 SASI_Hs01_00087715 predicted 791
8 SASI_Hs01_00087716 predicted 919
9 SASI_Hs01_00087717 predicted 1268
10 SASI_Hs02_00332764 predicted 770
11 SASI_Hs01_00087708 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107409 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228535 predicted 385
2 SASI_Rn02_00228536 predicted 708
3 SASI_Rn02_00228537 predicted 1120
4 SASI_Rn02_00228538 predicted 328
5 SASI_Rn02_00228539 predicted 813
6 SASI_Rn02_00228540 predicted 265
7 SASI_Rn02_00228541 predicted 1100
8 SASI_Rn02_00228542 predicted 653
9 SASI_Rn02_00228543 predicted 606
10 SASI_Rn02_00228544 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009974 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317561 predicted 633
2 SASI_Mm01_00134421 predicted 756
3 SASI_Mm02_00317562 predicted 1493
4 SASI_Mm01_00134423 predicted 1125
5 SASI_Mm01_00134424 predicted 706
6 SASI_Mm01_00134426 predicted 642
7 SASI_Mm01_00134428 predicted 1032
8 SASI_Mm02_00317563 predicted 706
9 SASI_Mm02_00317564 predicted 1027
10 SASI_Mm02_00317565 predicted 849
11 SASI_Mm01_00134420 predicted 1470
12 SASI_Mm01_00134422 predicted 1057
13 SASI_Mm01_00134425 predicted 1139
14 SASI_Mm01_00134427 predicted 961
15 SASI_Mm01_00134429 predicted 1153
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001896
VALIDATED
CSNK2A2 MISSION shRNA Bacterial Glycerol Stock
casein kinase 2, alpha prime polypeptide
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001896.2-1260s21c1
Sequence:GTACCGGTCAAACGTCTTAACGCGTATACTCGAGTATACGCGTTAAGACGTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001896.2-410s21c1
Sequence:CCGGCGTGGTGGAACAAATATCATTCTCGAGAATGATATTTGTTCCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001896.2-962s21c1
Sequence:CCGGCTGGGACAACATTCACGGAAACTCGAGTTTCCGTGAATGTTGTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001896.2-751s21c1
Sequence:CCGGCCTCGTGGACTATCAGATGTACTCGAGTACATCTGATAGTCCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001896.2-620s21c1
Sequence:CCGGCCTCACAATGTCATGATAGATCTCGAGATCTATCATGACATTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001896.2-1370s21c1
Sequence:GTACCGGATCAAACCTCACTTCCGAATGCTCGAGCATTCGGAAGTGAGGTTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001896.2-1463s21c1
Sequence:GTACCGGATGCAGAATGTTGTTGGTTACCTCGAGGTAACCAACAACATTCTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197008    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001896.2-1465s1c1
Sequence:CCGGGCAGAATGTTGTTGGTTACTGCTCGAGCAGTAACCAACAACATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001896.2-620s1c1
Sequence:CCGGCCTCACAATGTCATGATAGATCTCGAGATCTATCATGACATTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001896.2-523s1c1
Sequence:CCGGGATCCTGACAGACTTTGATATCTCGAGATATCAAAGTCTGTCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001896.2-311s1c1
Sequence:CCGGGCCATTAATATCACCAACAATCTCGAGATTGTTGGTGATATTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001896.x-983s1c1
Sequence:CCGGCTGGGACAACATTCACGGAAACTCGAGTTTCCGTGAATGTTGTCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001896.x-431s1c1
Sequence:CCGGCGTGGTGGAACAAATATCATTCTCGAGAATGATATTTGTTCCACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001896.x-955s1c1
Sequence:CCGGAGACCTAGATCCACACTTCAACTCGAGTTGAAGTGTGGATCTAGGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001896.x-772s1c1
Sequence:CCGGCCTCGTGGACTATCAGATGTACTCGAGTACATCTGATAGTCCACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000611    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001896.x-1619s1c1
Sequence:CCGGGCGGCAGTTACATATTATTATCTCGAGATAATAATATGTAACTGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001896
VALIDATED
CSNK2A2 MISSION shRNA shRNA Plasmid DNA
casein kinase 2, alpha prime polypeptide
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001896.2-1260s21c1
Sequence:GTACCGGTCAAACGTCTTAACGCGTATACTCGAGTATACGCGTTAAGACGTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001896.2-410s21c1
Sequence:CCGGCGTGGTGGAACAAATATCATTCTCGAGAATGATATTTGTTCCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001896.2-962s21c1
Sequence:CCGGCTGGGACAACATTCACGGAAACTCGAGTTTCCGTGAATGTTGTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001896.2-751s21c1
Sequence:CCGGCCTCGTGGACTATCAGATGTACTCGAGTACATCTGATAGTCCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001896.2-620s21c1
Sequence:CCGGCCTCACAATGTCATGATAGATCTCGAGATCTATCATGACATTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001896.2-1370s21c1
Sequence:GTACCGGATCAAACCTCACTTCCGAATGCTCGAGCATTCGGAAGTGAGGTTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001896.2-1463s21c1
Sequence:GTACCGGATGCAGAATGTTGTTGGTTACCTCGAGGTAACCAACAACATTCTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197008    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001896.2-1465s1c1
Sequence:CCGGGCAGAATGTTGTTGGTTACTGCTCGAGCAGTAACCAACAACATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001896.2-620s1c1
Sequence:CCGGCCTCACAATGTCATGATAGATCTCGAGATCTATCATGACATTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001896.2-523s1c1
Sequence:CCGGGATCCTGACAGACTTTGATATCTCGAGATATCAAAGTCTGTCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001896.2-311s1c1
Sequence:CCGGGCCATTAATATCACCAACAATCTCGAGATTGTTGGTGATATTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001896.x-983s1c1
Sequence:CCGGCTGGGACAACATTCACGGAAACTCGAGTTTCCGTGAATGTTGTCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001896.x-431s1c1
Sequence:CCGGCGTGGTGGAACAAATATCATTCTCGAGAATGATATTTGTTCCACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001896.x-955s1c1
Sequence:CCGGAGACCTAGATCCACACTTCAACTCGAGTTGAAGTGTGGATCTAGGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001896.x-772s1c1
Sequence:CCGGCCTCGTGGACTATCAGATGTACTCGAGTACATCTGATAGTCCACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000611    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001896.x-1619s1c1
Sequence:CCGGGCGGCAGTTACATATTATTATCTCGAGATAATAATATGTAACTGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001896
VALIDATED
CSNK2A2 MISSION shRNA Lentiviral Transduction Particles
casein kinase 2, alpha prime polypeptide
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001896.2-1260s21c1
Sequence:GTACCGGTCAAACGTCTTAACGCGTATACTCGAGTATACGCGTTAAGACGTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001896.2-410s21c1
Sequence:CCGGCGTGGTGGAACAAATATCATTCTCGAGAATGATATTTGTTCCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001896.2-962s21c1
Sequence:CCGGCTGGGACAACATTCACGGAAACTCGAGTTTCCGTGAATGTTGTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001896.2-751s21c1
Sequence:CCGGCCTCGTGGACTATCAGATGTACTCGAGTACATCTGATAGTCCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001896.2-620s21c1
Sequence:CCGGCCTCACAATGTCATGATAGATCTCGAGATCTATCATGACATTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001896.2-1370s21c1
Sequence:GTACCGGATCAAACCTCACTTCCGAATGCTCGAGCATTCGGAAGTGAGGTTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001896.2-1463s21c1
Sequence:GTACCGGATGCAGAATGTTGTTGGTTACCTCGAGGTAACCAACAACATTCTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197008    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001896.2-1465s1c1
Sequence:CCGGGCAGAATGTTGTTGGTTACTGCTCGAGCAGTAACCAACAACATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001896.2-620s1c1
Sequence:CCGGCCTCACAATGTCATGATAGATCTCGAGATCTATCATGACATTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001896.2-523s1c1
Sequence:CCGGGATCCTGACAGACTTTGATATCTCGAGATATCAAAGTCTGTCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001896.2-311s1c1
Sequence:CCGGGCCATTAATATCACCAACAATCTCGAGATTGTTGGTGATATTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001896.x-983s1c1
Sequence:CCGGCTGGGACAACATTCACGGAAACTCGAGTTTCCGTGAATGTTGTCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001896.x-431s1c1
Sequence:CCGGCGTGGTGGAACAAATATCATTCTCGAGAATGATATTTGTTCCACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001896.x-955s1c1
Sequence:CCGGAGACCTAGATCCACACTTCAACTCGAGTTGAAGTGTGGATCTAGGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001896.x-772s1c1
Sequence:CCGGCCTCGTGGACTATCAGATGTACTCGAGTACATCTGATAGTCCACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000611    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001896.x-1619s1c1
Sequence:CCGGGCGGCAGTTACATATTATTATCTCGAGATAATAATATGTAACTGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009974
VALIDATED
CSNK2A2 MISSION shRNA Bacterial Glycerol Stock
casein kinase 2, alpha prime polypeptide
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009974.3-1304s21c1
Sequence:CCGGCAACAGAGATTGACCGCCAAACTCGAGTTTGGCGGTCAATCTCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009974.3-1082s21c1
Sequence:CCGGCAGGACAACTATGACCAGCTTCTCGAGAAGCTGGTCATAGTTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009974.3-1186s21c1
Sequence:CCGGTGATATCCTGGGACAACATTCCTCGAGGAATGTTGTCCCAGGATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009974.3-1888s21c1
Sequence:CCGGGAAGTGGATGGAGCGTATTTACTCGAGTAAATACGCTCCATCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009974.3-528s21c1
Sequence:CCGGGTGAAGTATTTGAGGCCATTACTCGAGTAATGGCCTCAAATACTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009974.2-498s1c1
Sequence:CCGGGTGAAGTATTTGAGGCCATTACTCGAGTAATGGCCTCAAATACTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009974.2-1274s1c1
Sequence:CCGGCAACAGAGATTGACCGCCAAACTCGAGTTTGGCGGTCAATCTCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009974.2-671s1c1
Sequence:CCGGCCAGCTTTGGTATTTGAATATCTCGAGATATTCAAATACCAAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009974.2-970s1c1
Sequence:CCGGGTATGATTATAGCTTGGACATCTCGAGATGTCCAAGCTATAATCATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009974
VALIDATED
CSNK2A2 MISSION shRNA shRNA Plasmid DNA
casein kinase 2, alpha prime polypeptide
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009974.3-1304s21c1
Sequence:CCGGCAACAGAGATTGACCGCCAAACTCGAGTTTGGCGGTCAATCTCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009974.3-1082s21c1
Sequence:CCGGCAGGACAACTATGACCAGCTTCTCGAGAAGCTGGTCATAGTTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009974.3-1186s21c1
Sequence:CCGGTGATATCCTGGGACAACATTCCTCGAGGAATGTTGTCCCAGGATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009974.3-1888s21c1
Sequence:CCGGGAAGTGGATGGAGCGTATTTACTCGAGTAAATACGCTCCATCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009974.3-528s21c1
Sequence:CCGGGTGAAGTATTTGAGGCCATTACTCGAGTAATGGCCTCAAATACTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009974.2-498s1c1
Sequence:CCGGGTGAAGTATTTGAGGCCATTACTCGAGTAATGGCCTCAAATACTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009974.2-1274s1c1
Sequence:CCGGCAACAGAGATTGACCGCCAAACTCGAGTTTGGCGGTCAATCTCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009974.2-671s1c1
Sequence:CCGGCCAGCTTTGGTATTTGAATATCTCGAGATATTCAAATACCAAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009974.2-970s1c1
Sequence:CCGGGTATGATTATAGCTTGGACATCTCGAGATGTCCAAGCTATAATCATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009974
VALIDATED
CSNK2A2 MISSION shRNA Lentiviral Transduction Particles
casein kinase 2, alpha prime polypeptide
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009974.3-1304s21c1
Sequence:CCGGCAACAGAGATTGACCGCCAAACTCGAGTTTGGCGGTCAATCTCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009974.3-1082s21c1
Sequence:CCGGCAGGACAACTATGACCAGCTTCTCGAGAAGCTGGTCATAGTTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009974.3-1186s21c1
Sequence:CCGGTGATATCCTGGGACAACATTCCTCGAGGAATGTTGTCCCAGGATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009974.3-1888s21c1
Sequence:CCGGGAAGTGGATGGAGCGTATTTACTCGAGTAAATACGCTCCATCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009974.3-528s21c1
Sequence:CCGGGTGAAGTATTTGAGGCCATTACTCGAGTAATGGCCTCAAATACTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009974.2-498s1c1
Sequence:CCGGGTGAAGTATTTGAGGCCATTACTCGAGTAATGGCCTCAAATACTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009974.2-1274s1c1
Sequence:CCGGCAACAGAGATTGACCGCCAAACTCGAGTTTGGCGGTCAATCTCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009974.2-671s1c1
Sequence:CCGGCCAGCTTTGGTATTTGAATATCTCGAGATATTCAAATACCAAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009974.2-970s1c1
Sequence:CCGGGTATGATTATAGCTTGGACATCTCGAGATGTCCAAGCTATAATCATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks