EMAIL THIS PAGE TO A FRIEND

CSNK2B

casein kinase 2, beta polypeptide

93 Gene Product Result for
Synonyms: CK2B CK2N CSK2B G5A
UniProtKB ID: P67870, B0UXA9, P07312, P13862, Q4VX47
Gene ID:
Human(1460) Summary: This gene encodes the beta subunit of casein kinase II, a ubiquitous protein kinase which regulates metabolic pathways, signal transduction, transcription, translation, and replication. The enzyme is composed of three subunits, alpha, alpha prime and beta, which form a tetrameric holoenzyme. The alpha and alpha prime subunits are catalytic, while the beta subunit serves regulatory functions. The enzyme localizes to the endoplasmic reticulum and the Golgi apparatus. [provided by RefSeq, Jul 2008]
Mouse(13001) casein kinase 2, beta polypeptide
Rat(81650) casein kinase 2, beta polypeptide
chicken(100873151) casein kinase 2, beta polypeptide
cow(539235) casein kinase 2, beta polypeptide
domestic cat(101087664) casein kinase 2, beta polypeptide
dog(474844) casein kinase 2, beta polypeptide
domestic guinea pig(100721543) casein kinase 2, beta polypeptide
naked mole-rat(101707338) casein kinase 2, beta polypeptide
Goat(100860978) casein kinase 2, beta polypeptide
Domestic Rabbit(100301531) casein kinase 2, beta polypeptide
sheep(100216435) casein kinase 2, beta polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C3617 Anti-Casein Kinase 2β antibody, Mouse monoclonal clone 6D5, purified from hybridoma cell culture mouse, rat, human, bovine, hamster
dot blot, ELISA, microarray, western blot pricing
SAB4500516 Anti-CKII-β, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
C4119 Anti-CSNK2B (36-50) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1405669 Anti-CSNK2B antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB4504149 Anti-phospho-CKII-β (pSer209) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
PLA0226 Rabbit anti-CKII beta Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. rat, pig, chicken, goat, bovine, human, sheep, dog, rabbit, horse, mouse, guinea pig
immunoprecipitation, proximity ligation assay, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D1916 5,6-Dichlorobenzimidazole 1-β-D-ribofuranoside human pricing
E7881 Emodin from Frangula bark, ≥90% (HPLC) human pricing

Small Molecule - Substrate

Product # Description Species Add to Cart
 
A2793 Arg-Arg-Arg-Glu-Glu-Glu-Thr-Glu-Glu-Glu lyophilized powder human, mouse, rat pricing
C2460 Casein Kinase II substrate ≥97% (HPLC) human, mouse, rat pricing

Kits

Product # Description Species Add to Cart
 
CS0610 Casein Kinase II Assay Kit sufficient for 70 reactions human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001320 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001320 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001320 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009975 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009975 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009975 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU019621 MISSION® esiRNA esiRNA targeting mouse Csnk2b (esiRNA1) mouse pricing

Related Products

Product # Description Species Add to Cart
 
12-529 CK1tide 1 mg pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001320 Rosetta Predictions human pricing
NM_001035238 Rosetta Predictions rat pricing
NM_031021 Rosetta Predictions rat pricing
NM_009975 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181021 predicted 659
2 SASI_Hs01_00181022 predicted 429
3 SASI_Hs01_00181023 predicted 484
4 SASI_Hs01_00181024 predicted 534
5 SASI_Hs01_00181025 predicted 801
6 SASI_Hs01_00181026 predicted 638
7 SASI_Hs02_00331619 predicted 823
8 SASI_Hs01_00181028 predicted 472
9 SASI_Hs01_00181029 predicted 687
10 SASI_Hs02_00331620 predicted 849
11 SASI_Hs01_00181027 predicted 399
12 SASI_Hs01_00181030 predicted 827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035238 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089668 predicted 275
2 SASI_Rn01_00089670 predicted 383
3 SASI_Rn01_00089672 predicted 302
4 SASI_Rn01_00089673 predicted 397
5 SASI_Rn02_00204193 predicted 298
6 SASI_Rn02_00204194 predicted 304
7 SASI_Rn01_00089676 predicted 320
8 SASI_Rn01_00089677 predicted 562
9 SASI_Rn02_00204195 predicted 347
10 SASI_Rn02_00204196 predicted 449
11 SASI_Rn01_00089669 predicted 548
12 SASI_Rn01_00089671 predicted 555
13 SASI_Rn01_00089674 predicted 436
14 SASI_Rn01_00089675 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031021 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119166 predicted 302
2 SASI_Rn01_00119168 predicted 416
3 SASI_Rn01_00119170 predicted 334
4 SASI_Rn01_00119171 predicted 432
5 SASI_Rn02_00264214 predicted 336
6 SASI_Rn02_00264215 predicted 336
7 SASI_Rn01_00119174 predicted 345
8 SASI_Rn01_00119175 predicted 602
9 SASI_Rn02_00264216 predicted 381
10 SASI_Rn02_00264217 predicted 486
11 SASI_Rn01_00119167 predicted 585
12 SASI_Rn01_00119169 predicted 588
13 SASI_Rn01_00119172 predicted 465
14 SASI_Rn01_00119173 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009975 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317566 predicted 798
2 SASI_Mm01_00153769 predicted 884
3 SASI_Mm01_00153770 predicted 560
4 SASI_Mm01_00153771 predicted 654
5 SASI_Mm01_00153772 predicted 467
6 SASI_Mm01_00153773 predicted 825
7 SASI_Mm01_00153774 predicted 481
8 SASI_Mm01_00153775 predicted 577
9 SASI_Mm01_00153776 predicted 417
10 SASI_Mm01_00153777 predicted 607
11 SASI_Mm01_00153778 predicted 770
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001320
VALIDATED
CSNK2B MISSION shRNA Bacterial Glycerol Stock
casein kinase 2, beta polypeptide
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001320.x-655s1c1
Sequence:CCGGCTTTGGTTACTGTCCTCGTGTCTCGAGACACGAGGACAGTAACCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001320.x-596s1c1
Sequence:CCGGCGCTACATCCTTACCAACCGTCTCGAGACGGTTGGTAAGGATGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001320.x-418s1c1
Sequence:CCGGTGAAGACTACATCCAGGACAACTCGAGTTGTCCTGGATGTAGTCTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001320.x-823s1c1
Sequence:CCGGTGGTTTCCCTCACATGCTCTTCTCGAGAAGAGCATGTGAGGGAAACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001320.x-382s1c1
Sequence:CCGGTGGGCTCCGTGGCAATGAATTCTCGAGAATTCATTGCCACGGAGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001320.5-760s1c1
Sequence:CCGGCATGGATGTGTACACACCCAACTCGAGTTGGGTGTGTACACATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001320.5-430s1c1
Sequence:CCGGCCAGGACAAATTTAATCTTACCTCGAGGTAAGATTAAATTTGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001320.5-485s1c1
Sequence:CCGGGCTCTAGACATGATCTTGGACCTCGAGGTCCAAGATCATGTCTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001320.5-646s1c1
Sequence:CCGGGCAAGGAGACTTTGGTTACTGCTCGAGCAGTAACCAAAGTCTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001320.5-772s1c1
Sequence:CCGGCACACCCAAGTCATCAAGACACTCGAGTGTCTTGATGACTTGGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001320.5-702s1c1
Sequence:CCGGCCATTGGCCTTTCAGACATCCCTCGAGGGATGTCTGAAAGGCCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001320.5-892s1c1
Sequence:CCGGGCCCAGGCTCTACGGTTTCAACTCGAGTTGAAACCGTAGAGCCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001320.5-423s21c1
Sequence:CCGGACTACATCCAGGACAAATTTACTCGAGTAAATTTGTCCTGGATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001320.5-560s21c1
Sequence:CCGGCAGGCAGCCGAGATGCTTTATCTCGAGATAAAGCATCTCGGCTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001320.5-537s1c1
Sequence:CCGGCCAACCAGAGTGACCTGATTGCTCGAGCAATCAGGTCACTCTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001320.5-870s21c1
Sequence:CCGGAGAGACCTGCCAACCAGTTTGCTCGAGCAAACTGGTTGGCAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001320.5-639s21c1
Sequence:CCGGAGTACCAGCAAGGAGACTTTGCTCGAGCAAAGTCTCCTTGCTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001320.5-537s21c1
Sequence:CCGGCCAACCAGAGTGACCTGATTGCTCGAGCAATCAGGTCACTCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001320
VALIDATED
CSNK2B MISSION shRNA shRNA Plasmid DNA
casein kinase 2, beta polypeptide
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001320.x-655s1c1
Sequence:CCGGCTTTGGTTACTGTCCTCGTGTCTCGAGACACGAGGACAGTAACCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001320.x-596s1c1
Sequence:CCGGCGCTACATCCTTACCAACCGTCTCGAGACGGTTGGTAAGGATGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001320.x-418s1c1
Sequence:CCGGTGAAGACTACATCCAGGACAACTCGAGTTGTCCTGGATGTAGTCTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001320.x-823s1c1
Sequence:CCGGTGGTTTCCCTCACATGCTCTTCTCGAGAAGAGCATGTGAGGGAAACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001320.x-382s1c1
Sequence:CCGGTGGGCTCCGTGGCAATGAATTCTCGAGAATTCATTGCCACGGAGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001320.5-760s1c1
Sequence:CCGGCATGGATGTGTACACACCCAACTCGAGTTGGGTGTGTACACATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001320.5-430s1c1
Sequence:CCGGCCAGGACAAATTTAATCTTACCTCGAGGTAAGATTAAATTTGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001320.5-485s1c1
Sequence:CCGGGCTCTAGACATGATCTTGGACCTCGAGGTCCAAGATCATGTCTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001320.5-646s1c1
Sequence:CCGGGCAAGGAGACTTTGGTTACTGCTCGAGCAGTAACCAAAGTCTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001320.5-772s1c1
Sequence:CCGGCACACCCAAGTCATCAAGACACTCGAGTGTCTTGATGACTTGGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001320.5-702s1c1
Sequence:CCGGCCATTGGCCTTTCAGACATCCCTCGAGGGATGTCTGAAAGGCCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001320.5-892s1c1
Sequence:CCGGGCCCAGGCTCTACGGTTTCAACTCGAGTTGAAACCGTAGAGCCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001320.5-423s21c1
Sequence:CCGGACTACATCCAGGACAAATTTACTCGAGTAAATTTGTCCTGGATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001320.5-560s21c1
Sequence:CCGGCAGGCAGCCGAGATGCTTTATCTCGAGATAAAGCATCTCGGCTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001320.5-537s1c1
Sequence:CCGGCCAACCAGAGTGACCTGATTGCTCGAGCAATCAGGTCACTCTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001320.5-870s21c1
Sequence:CCGGAGAGACCTGCCAACCAGTTTGCTCGAGCAAACTGGTTGGCAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001320.5-639s21c1
Sequence:CCGGAGTACCAGCAAGGAGACTTTGCTCGAGCAAAGTCTCCTTGCTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001320.5-537s21c1
Sequence:CCGGCCAACCAGAGTGACCTGATTGCTCGAGCAATCAGGTCACTCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001320
VALIDATED
CSNK2B MISSION shRNA Lentiviral Transduction Particles
casein kinase 2, beta polypeptide
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001320.x-655s1c1
Sequence:CCGGCTTTGGTTACTGTCCTCGTGTCTCGAGACACGAGGACAGTAACCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001320.x-596s1c1
Sequence:CCGGCGCTACATCCTTACCAACCGTCTCGAGACGGTTGGTAAGGATGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001320.x-418s1c1
Sequence:CCGGTGAAGACTACATCCAGGACAACTCGAGTTGTCCTGGATGTAGTCTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001320.x-823s1c1
Sequence:CCGGTGGTTTCCCTCACATGCTCTTCTCGAGAAGAGCATGTGAGGGAAACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001320.x-382s1c1
Sequence:CCGGTGGGCTCCGTGGCAATGAATTCTCGAGAATTCATTGCCACGGAGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001320.5-760s1c1
Sequence:CCGGCATGGATGTGTACACACCCAACTCGAGTTGGGTGTGTACACATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001320.5-430s1c1
Sequence:CCGGCCAGGACAAATTTAATCTTACCTCGAGGTAAGATTAAATTTGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001320.5-485s1c1
Sequence:CCGGGCTCTAGACATGATCTTGGACCTCGAGGTCCAAGATCATGTCTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001320.5-646s1c1
Sequence:CCGGGCAAGGAGACTTTGGTTACTGCTCGAGCAGTAACCAAAGTCTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001320.5-772s1c1
Sequence:CCGGCACACCCAAGTCATCAAGACACTCGAGTGTCTTGATGACTTGGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001320.5-702s1c1
Sequence:CCGGCCATTGGCCTTTCAGACATCCCTCGAGGGATGTCTGAAAGGCCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001320.5-892s1c1
Sequence:CCGGGCCCAGGCTCTACGGTTTCAACTCGAGTTGAAACCGTAGAGCCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001320.5-423s21c1
Sequence:CCGGACTACATCCAGGACAAATTTACTCGAGTAAATTTGTCCTGGATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001320.5-560s21c1
Sequence:CCGGCAGGCAGCCGAGATGCTTTATCTCGAGATAAAGCATCTCGGCTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001320.5-537s1c1
Sequence:CCGGCCAACCAGAGTGACCTGATTGCTCGAGCAATCAGGTCACTCTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001320.5-870s21c1
Sequence:CCGGAGAGACCTGCCAACCAGTTTGCTCGAGCAAACTGGTTGGCAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001320.5-639s21c1
Sequence:CCGGAGTACCAGCAAGGAGACTTTGCTCGAGCAAAGTCTCCTTGCTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001320.5-537s21c1
Sequence:CCGGCCAACCAGAGTGACCTGATTGCTCGAGCAATCAGGTCACTCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009975
VALIDATED
CSNK2B MISSION shRNA Bacterial Glycerol Stock
casein kinase 2, beta polypeptide
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009975.1-825s1c1
Sequence:CCGGCACATGCTCTTCATGGTGCATCTCGAGATGCACCATGAAGAGCATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009975.1-483s1c1
Sequence:CCGGGACATGATCTTAGACCTGGAACTCGAGTTCCAGGTCTAAGATCATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009975.1-891s1c1
Sequence:CCGGCTCTATGGTTTCAAGATCCATCTCGAGATGGATCTTGAAACCATAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009975.1-377s1c1
Sequence:CCGGGCTCCGTGGTAATGAATTCTTCTCGAGAAGAATTCATTACCACGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009975.1-610s1c1
Sequence:CCGGGCATCGCACAAATGTTGGAAACTCGAGTTTCCAACATTTGTGCGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009975.2-488s21c1
Sequence:CCGGGACATGATCTTAGACCTGGAACTCGAGTTCCAGGTCTAAGATCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009975.2-615s21c1
Sequence:CCGGGCATCGCACAAATGTTGGAAACTCGAGTTTCCAACATTTGTGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009975.2-896s21c1
Sequence:CCGGCTCTATGGTTTCAAGATCCATCTCGAGATGGATCTTGAAACCATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009975.2-830s21c1
Sequence:CCGGCACATGCTCTTCATGGTGCATCTCGAGATGCACCATGAAGAGCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009975.2-382s21c1
Sequence:CCGGGCTCCGTGGTAATGAATTCTTCTCGAGAAGAATTCATTACCACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009975
VALIDATED
CSNK2B MISSION shRNA shRNA Plasmid DNA
casein kinase 2, beta polypeptide
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009975.1-825s1c1
Sequence:CCGGCACATGCTCTTCATGGTGCATCTCGAGATGCACCATGAAGAGCATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009975.1-483s1c1
Sequence:CCGGGACATGATCTTAGACCTGGAACTCGAGTTCCAGGTCTAAGATCATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009975.1-891s1c1
Sequence:CCGGCTCTATGGTTTCAAGATCCATCTCGAGATGGATCTTGAAACCATAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009975.1-377s1c1
Sequence:CCGGGCTCCGTGGTAATGAATTCTTCTCGAGAAGAATTCATTACCACGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009975.1-610s1c1
Sequence:CCGGGCATCGCACAAATGTTGGAAACTCGAGTTTCCAACATTTGTGCGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009975.2-488s21c1
Sequence:CCGGGACATGATCTTAGACCTGGAACTCGAGTTCCAGGTCTAAGATCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009975.2-615s21c1
Sequence:CCGGGCATCGCACAAATGTTGGAAACTCGAGTTTCCAACATTTGTGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009975.2-896s21c1
Sequence:CCGGCTCTATGGTTTCAAGATCCATCTCGAGATGGATCTTGAAACCATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009975.2-830s21c1
Sequence:CCGGCACATGCTCTTCATGGTGCATCTCGAGATGCACCATGAAGAGCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009975.2-382s21c1
Sequence:CCGGGCTCCGTGGTAATGAATTCTTCTCGAGAAGAATTCATTACCACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009975
VALIDATED
CSNK2B MISSION shRNA Lentiviral Transduction Particles
casein kinase 2, beta polypeptide
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009975.1-825s1c1
Sequence:CCGGCACATGCTCTTCATGGTGCATCTCGAGATGCACCATGAAGAGCATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009975.1-483s1c1
Sequence:CCGGGACATGATCTTAGACCTGGAACTCGAGTTCCAGGTCTAAGATCATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009975.1-891s1c1
Sequence:CCGGCTCTATGGTTTCAAGATCCATCTCGAGATGGATCTTGAAACCATAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009975.1-377s1c1
Sequence:CCGGGCTCCGTGGTAATGAATTCTTCTCGAGAAGAATTCATTACCACGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009975.1-610s1c1
Sequence:CCGGGCATCGCACAAATGTTGGAAACTCGAGTTTCCAACATTTGTGCGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009975.2-488s21c1
Sequence:CCGGGACATGATCTTAGACCTGGAACTCGAGTTCCAGGTCTAAGATCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009975.2-615s21c1
Sequence:CCGGGCATCGCACAAATGTTGGAAACTCGAGTTTCCAACATTTGTGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009975.2-896s21c1
Sequence:CCGGCTCTATGGTTTCAAGATCCATCTCGAGATGGATCTTGAAACCATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009975.2-830s21c1
Sequence:CCGGCACATGCTCTTCATGGTGCATCTCGAGATGCACCATGAAGAGCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009975.2-382s21c1
Sequence:CCGGGCTCCGTGGTAATGAATTCTTCTCGAGAAGAATTCATTACCACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks