EMAIL THIS PAGE TO A FRIEND

CSPG4

chondroitin sulfate proteoglycan 4

69 Gene Product Result for
Synonyms: HMW-MAA MCSP MCSPG MEL-CSPG MSK16 NG2
UniProtKB ID: Q6UVK1, D3DW77, Q92675
Gene ID:
Human(1464) Summary: A human melanoma-associated chondroitin sulfate proteoglycan plays a role in stabilizing cell-substratum interactions during early events of melanoma cell spreading on endothelial basement membranes. CSPG4 represents an integral membrane chondroitin sulfate proteoglycan expressed by human malignant melanoma cells. [provided by RefSeq, Jul 2008]
Mouse(121021) chondroitin sulfate proteoglycan 4
Rat(81651) chondroitin sulfate proteoglycan 4
Zebrafish(560393) chondroitin sulfate proteoglycan 4
cow(533653) chondroitin sulfate proteoglycan 4
Horse(100061543) chondroitin sulfate proteoglycan 4
domestic cat(101097242) chondroitin sulfate proteoglycan 4
dog(487658) chondroitin sulfate proteoglycan 4
chicken(425524) chondroitin sulfate proteoglycan 4
domestic guinea pig(100734601) chondroitin sulfate proteoglycan 4
naked mole-rat(101720313) chondroitin sulfate proteoglycan 4
sheep(101105108) chondroitin sulfate proteoglycan 4
Domestic Rabbit(100344870) chondroitin sulfate proteoglycan 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1594 Human NG2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001897 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001897 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001897 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139001 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139001 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139001 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149911 MISSION® esiRNA esiRNA human CSPG4 (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
MAB2030 Anti-Chondroitin 4 Sulfate Antibody, clone BE-123 100 µL, Anti-Chondroitin 4 Sulfate Antibody, clone BE-123 detects level of Chondroitin 4 Sulfate & has been published & validated for use in ELISA, RIA & WB. pricing
MAB2029 Anti-Chondroitin Sulfate Proteoglycan Antibody, clone 9.2.27 100 µg, Detect Chondroitin Sulfate Proteoglycan using this Anti-Chondroitin Sulfate Proteoglycan Antibody, clone 9.2.27 validated for use in FC, IF & IP. pricing
AB5320A4 Anti-NG2, Alexa Fluor®488 Conjugate Antibody 100 µL, Anti-NG2, Alexa Fluor®488 Conjugate Antibody detects level of NG2 & has been published & validated for use in ICC & IHC. pricing
05-710 Anti-NG2 Antibody, clone 132.38 200 µg, Anti-NG2 Antibody, clone 132.38 detects level of NG2 & has been published & validated for use in IH & WB. pricing
MAB5384A4 Anti-NG2 Antibody, clone 132.39, Alexa Fluor®488 Conjugate 100 µL, Anti-NG2 Antibody, clone 132.39, Alexa Fluor®488 Conjugate detects level of NG2 & has been published & validated for use in ICC. pricing
AB5320 Anti-NG2 Chondroitin Sulfate Proteoglycan Antibody 100 µg, Detect NG2 Chondroitin Sulfate Proteoglycan using this Anti-NG2 Chondroitin Sulfate Proteoglycan Antibody validated for use in ELISA, IC, IH, IP and WB. pricing
MAB5384 Anti-NG2 Chondroitin Sulfate Proteoglycan Antibody 100 µg, Anti-NG2 Chondroitin Sulfate Proteoglycan Antibody detects level of NG2 Chondroitin Sulfate Proteoglycan & has been published & validated for use in WB, IC, ELISA, IH. pricing
MAB5520 Anti-NG2 Chondroitin Sulfate Proteoglycan Antibody, clone 7.1 100 µL, Anti-NG2 Chondroitin Sulfate Proteoglycan Antibody, clone 7.1 is an antibody against NG2 Chondroitin Sulfate Proteoglycan for use in FC & WB. pricing
AB5320B Anti-NG2 Chondroitin Sulfate Proteoglycan, Biotin Conjugate Antibody 100 µL, Anti-NG2 Chondroitin Sulfate Proteoglycan, Biotin Conjugate Antibody is an antibody against NG2 Chondroitin Sulfate Proteoglycan for use in IHC, ICC. pricing
AB5320C3 Anti-NG2 Chondroitin Sulfate Proteoglycan, Cy3 Conjugate Antibody 100 µL, Anti-NG2 Chondroitin Sulfate Proteoglycan, Cy3 Conjugate Antibody is an antibody against NG2 Chondroitin Sulfate Proteoglycan for use in ICC & IHC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001897 Rosetta Predictions human pricing
NM_031022 Rosetta Predictions rat pricing
NM_139001 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001897 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114896 predicted 6748
2 SASI_Hs01_00114897 predicted 894
3 SASI_Hs01_00114898 predicted 3283
4 SASI_Hs01_00114899 predicted 3801
5 SASI_Hs01_00114900 predicted 2589
6 SASI_Hs01_00114902 predicted 2856
7 SASI_Hs02_00332765 predicted 3903
8 SASI_Hs01_00114903 predicted 6558
9 SASI_Hs01_00114904 predicted 1250
10 SASI_Hs01_00114905 predicted 6836
11 SASI_Hs01_00114901 predicted 3233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031022 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086748 predicted 4584
2 SASI_Rn01_00086749 predicted 1933
3 SASI_Rn01_00086751 predicted 3017
4 SASI_Rn02_00264218 predicted 1128
5 SASI_Rn01_00086752 predicted 2522
6 SASI_Rn01_00086753 predicted 1312
7 SASI_Rn01_00086755 predicted 6736
8 SASI_Rn01_00086756 predicted 2051
9 SASI_Rn01_00086757 predicted 2700
10 SASI_Rn02_00264219 predicted 5314
11 SASI_Rn01_00086750 predicted 3311
12 SASI_Rn01_00086754 predicted 4776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139001 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180514 predicted 3571
2 SASI_Mm01_00180516 predicted 6213
3 SASI_Mm01_00180517 predicted 1255
4 SASI_Mm01_00180518 predicted 5411
5 SASI_Mm01_00180520 predicted 2974
6 SASI_Mm02_00339861 predicted 3323
7 SASI_Mm01_00180521 predicted 2066
8 SASI_Mm01_00180522 predicted 3205
9 SASI_Mm01_00180523 predicted 2873
10 SASI_Mm02_00339862 predicted 2766
11 SASI_Mm01_00180515 predicted 5001
12 SASI_Mm01_00180519 predicted 1092
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001897
VALIDATED
CSPG4 MISSION shRNA Bacterial Glycerol Stock
chondroitin sulfate proteoglycan 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001897.4-3900s21c1
Sequence:CCCGGCCACCTGCAGACATCGTATTCTCGAGAATACGATGTCTGCAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001897.4-1258s21c1
Sequence:CCGGGACGATGCCTATGGACATTATCTCGAGATAATGTCCATAGGCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001897.4-5042s21c1
Sequence:CCGGAGGTCTACGCTGGGAATATTCCTCGAGGAATATTCCCAGCGTAGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001897.2-6099s1c1
Sequence:CCGGCAATGCATCAGCCGTAGTGAACTCGAGTTCACTACGGCTGATGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001897.2-5466s1c1
Sequence:CCGGCATCACGGTGAGGGATGTAAACTCGAGTTTACATCCCTCACCGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001897.2-6660s1c1
Sequence:CCGGCAACATGTTCAGCGTCATCATCTCGAGATGATGACGCTGAACATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001897.2-745s1c1
Sequence:CCGGGACTTCATCTATGTGGACATACTCGAGTATGTCCACATAGATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001897.2-6477s1c1
Sequence:CCGGCTTTGCCACTGAGCCTTACAACTCGAGTTGTAAGGCTCAGTGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001897.2-1156s1c1
Sequence:CCGGGAGTATGAGGACGATGCCTATCTCGAGATAGGCATCGTCCTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001897
VALIDATED
CSPG4 MISSION shRNA shRNA Plasmid DNA
chondroitin sulfate proteoglycan 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001897.4-3900s21c1
Sequence:CCCGGCCACCTGCAGACATCGTATTCTCGAGAATACGATGTCTGCAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001897.4-1258s21c1
Sequence:CCGGGACGATGCCTATGGACATTATCTCGAGATAATGTCCATAGGCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001897.4-5042s21c1
Sequence:CCGGAGGTCTACGCTGGGAATATTCCTCGAGGAATATTCCCAGCGTAGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001897.2-6099s1c1
Sequence:CCGGCAATGCATCAGCCGTAGTGAACTCGAGTTCACTACGGCTGATGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001897.2-5466s1c1
Sequence:CCGGCATCACGGTGAGGGATGTAAACTCGAGTTTACATCCCTCACCGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001897.2-6660s1c1
Sequence:CCGGCAACATGTTCAGCGTCATCATCTCGAGATGATGACGCTGAACATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001897.2-745s1c1
Sequence:CCGGGACTTCATCTATGTGGACATACTCGAGTATGTCCACATAGATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001897.2-6477s1c1
Sequence:CCGGCTTTGCCACTGAGCCTTACAACTCGAGTTGTAAGGCTCAGTGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001897.2-1156s1c1
Sequence:CCGGGAGTATGAGGACGATGCCTATCTCGAGATAGGCATCGTCCTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001897
VALIDATED
CSPG4 MISSION shRNA Lentiviral Transduction Particles
chondroitin sulfate proteoglycan 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001897.4-3900s21c1
Sequence:CCCGGCCACCTGCAGACATCGTATTCTCGAGAATACGATGTCTGCAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001897.4-1258s21c1
Sequence:CCGGGACGATGCCTATGGACATTATCTCGAGATAATGTCCATAGGCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001897.4-5042s21c1
Sequence:CCGGAGGTCTACGCTGGGAATATTCCTCGAGGAATATTCCCAGCGTAGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001897.2-6099s1c1
Sequence:CCGGCAATGCATCAGCCGTAGTGAACTCGAGTTCACTACGGCTGATGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001897.2-5466s1c1
Sequence:CCGGCATCACGGTGAGGGATGTAAACTCGAGTTTACATCCCTCACCGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001897.2-6660s1c1
Sequence:CCGGCAACATGTTCAGCGTCATCATCTCGAGATGATGACGCTGAACATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001897.2-745s1c1
Sequence:CCGGGACTTCATCTATGTGGACATACTCGAGTATGTCCACATAGATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001897.2-6477s1c1
Sequence:CCGGCTTTGCCACTGAGCCTTACAACTCGAGTTGTAAGGCTCAGTGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001897.2-1156s1c1
Sequence:CCGGGAGTATGAGGACGATGCCTATCTCGAGATAGGCATCGTCCTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139001
VALIDATED
CSPG4 MISSION shRNA Bacterial Glycerol Stock
chondroitin sulfate proteoglycan 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_139001.2-3474s21c1
Sequence:CCGGCCCTATCTTCACGTAGCCAATCTCGAGATTGGCTACGTGAAGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_139001.2-7353s21c1
Sequence:CCGGGAACTGTGACCTTAGATAAATCTCGAGATTTATCTAAGGTCACAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139001.2-820s21c1
Sequence:CCGGGGGACAAGCGTGGCAACTTTACTCGAGTAAAGTTGCCACGCTTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_139001.2-6202s21c1
Sequence:CCGGACGCATCAGCCACCGTAAATGCTCGAGCATTTACGGTGGCTGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139001.2-993s21c1
Sequence:CCGGCAATACCCTACGCGTACTTTCCTCGAGGAAAGTACGCGTAGGGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139001.1-3418s1c1
Sequence:CCGGCCCTATCTTCACGTAGCCAATCTCGAGATTGGCTACGTGAAGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139001.1-6345s1c1
Sequence:CCGGCCGAACAGAATCTAGGAGCAACTCGAGTTGCTCCTAGATTCTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139001.1-6362s1c1
Sequence:CCGGGCAACCAACTTGTGGAACATTCTCGAGAATGTTCCACAAGTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139001.1-1094s1c1
Sequence:CCGGGCATAGAAGATTTCAGTGTTACTCGAGTAACACTGAAATCTTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139001
VALIDATED
CSPG4 MISSION shRNA shRNA Plasmid DNA
chondroitin sulfate proteoglycan 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_139001.2-3474s21c1
Sequence:CCGGCCCTATCTTCACGTAGCCAATCTCGAGATTGGCTACGTGAAGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_139001.2-7353s21c1
Sequence:CCGGGAACTGTGACCTTAGATAAATCTCGAGATTTATCTAAGGTCACAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139001.2-820s21c1
Sequence:CCGGGGGACAAGCGTGGCAACTTTACTCGAGTAAAGTTGCCACGCTTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_139001.2-6202s21c1
Sequence:CCGGACGCATCAGCCACCGTAAATGCTCGAGCATTTACGGTGGCTGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139001.2-993s21c1
Sequence:CCGGCAATACCCTACGCGTACTTTCCTCGAGGAAAGTACGCGTAGGGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139001.1-3418s1c1
Sequence:CCGGCCCTATCTTCACGTAGCCAATCTCGAGATTGGCTACGTGAAGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139001.1-6345s1c1
Sequence:CCGGCCGAACAGAATCTAGGAGCAACTCGAGTTGCTCCTAGATTCTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139001.1-6362s1c1
Sequence:CCGGGCAACCAACTTGTGGAACATTCTCGAGAATGTTCCACAAGTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139001.1-1094s1c1
Sequence:CCGGGCATAGAAGATTTCAGTGTTACTCGAGTAACACTGAAATCTTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139001
VALIDATED
CSPG4 MISSION shRNA Lentiviral Transduction Particles
chondroitin sulfate proteoglycan 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_139001.2-3474s21c1
Sequence:CCGGCCCTATCTTCACGTAGCCAATCTCGAGATTGGCTACGTGAAGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_139001.2-7353s21c1
Sequence:CCGGGAACTGTGACCTTAGATAAATCTCGAGATTTATCTAAGGTCACAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139001.2-820s21c1
Sequence:CCGGGGGACAAGCGTGGCAACTTTACTCGAGTAAAGTTGCCACGCTTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_139001.2-6202s21c1
Sequence:CCGGACGCATCAGCCACCGTAAATGCTCGAGCATTTACGGTGGCTGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139001.2-993s21c1
Sequence:CCGGCAATACCCTACGCGTACTTTCCTCGAGGAAAGTACGCGTAGGGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139001.1-3418s1c1
Sequence:CCGGCCCTATCTTCACGTAGCCAATCTCGAGATTGGCTACGTGAAGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139001.1-6345s1c1
Sequence:CCGGCCGAACAGAATCTAGGAGCAACTCGAGTTGCTCCTAGATTCTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139001.1-6362s1c1
Sequence:CCGGGCAACCAACTTGTGGAACATTCTCGAGAATGTTCCACAAGTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139001.1-1094s1c1
Sequence:CCGGGCATAGAAGATTTCAGTGTTACTCGAGTAACACTGAAATCTTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks