EMAIL THIS PAGE TO A FRIEND

CSPG5

chondroitin sulfate proteoglycan 5 (neuroglycan C)

99 Gene Product Result for
Synonyms: NGC
UniProtKB ID: O95196, Q71M39, Q71M40
Gene ID:
Human(10675) Summary: The protein encoded by this gene is a proteoglycan that may function as a neural growth and differentiation factor. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Mouse(29873) chondroitin sulfate proteoglycan 5
Rat(50568) chondroitin sulfate proteoglycan 5 (neuroglycan C)
chicken(395466) chondroitin sulfate proteoglycan 5 (neuroglycan C)
dog(609188) chondroitin sulfate proteoglycan 5 (neuroglycan C)
domestic cat(101097954) chondroitin sulfate proteoglycan 5 (neuroglycan C)
cow(505866) chondroitin sulfate proteoglycan 5 (neuroglycan C)
sheep(101122060) chondroitin sulfate proteoglycan 5 (neuroglycan C)
naked mole-rat(101706513) chondroitin sulfate proteoglycan 5 (neuroglycan C)
domestic guinea pig(100724598) chondroitin sulfate proteoglycan 5 (neuroglycan C)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013884 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013884 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013884 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006574 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006574 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006574 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU158441 MISSION® esiRNA esiRNA targeting mouse Cspg5 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006574 Rosetta Predictions human pricing
NM_019284 Rosetta Predictions rat pricing
NM_133652 Rosetta Predictions rat pricing
NM_013884 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006574 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215877 predicted 1543
2 SASI_Hs01_00215878 predicted 1518
3 SASI_Hs02_00341861 predicted 723
4 SASI_Hs01_00215881 predicted 1291
5 SASI_Hs02_00341862 predicted 1573
6 SASI_Hs01_00215882 predicted 1253
7 SASI_Hs01_00215883 predicted 1365
8 SASI_Hs02_00341863 predicted 723
9 SASI_Hs01_00215885 predicted 1504
10 SASI_Hs01_00215886 predicted 1298
11 SASI_Hs01_00215879 predicted 1408
12 SASI_Hs01_00215880 predicted 560
13 SASI_Hs01_00215884 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019284 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101971 predicted 1251
2 SASI_Rn01_00101972 predicted 1094
3 SASI_Rn01_00101973 predicted 1143
4 SASI_Rn01_00101974 predicted 1259
5 SASI_Rn01_00101975 predicted 1092
6 SASI_Rn01_00101976 predicted 1123
7 SASI_Rn01_00101977 predicted 1150
8 SASI_Rn01_00101978 predicted 1138
9 SASI_Rn01_00101979 predicted 1102
10 SASI_Rn01_00101980 predicted 1134
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133652 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039563 predicted 1235
2 SASI_Rn01_00039564 predicted 1128
3 SASI_Rn01_00039565 predicted 1245
4 SASI_Rn01_00039566 predicted 1110
5 SASI_Rn01_00039567 predicted 1145
6 SASI_Rn01_00039568 predicted 1121
7 SASI_Rn01_00039569 predicted 1085
8 SASI_Rn01_00039570 predicted 1115
9 SASI_Rn02_00267862 predicted 1110
10 SASI_Rn01_00039571 predicted 1136
11 SASI_Rn01_00039572 predicted 1175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013884 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168620 predicted 1483
2 SASI_Mm01_00168621 predicted 1377
3 SASI_Mm01_00168622 predicted 1681
4 SASI_Mm02_00322910 predicted 1536
5 SASI_Mm01_00168623 predicted 1650
6 SASI_Mm01_00168624 predicted 1758
7 SASI_Mm01_00168625 predicted 1337
8 SASI_Mm01_00168626 predicted 1634
9 SASI_Mm02_00322911 predicted 1301
10 SASI_Mm01_00168627 predicted 990
11 SASI_Mm01_00168619 predicted 767
12 SASI_Mm01_00168628 predicted 1480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013884
CSPG5 MISSION shRNA Bacterial Glycerol Stock
chondroitin sulfate proteoglycan 5 (neuroglycan C)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013884.2-1837s1c1
Sequence:CCGGGCTTCTTGTAACCATTTGTTACTCGAGTAACAAATGGTTACAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013884.2-760s1c1
Sequence:CCGGGCCTCAGATATAATTGACATTCTCGAGAATGTCAATTATATCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013884.2-954s1c1
Sequence:CCGGCACATCCTTCTATGATGATTTCTCGAGAAATCATCATAGAAGGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013884.2-1494s1c1
Sequence:CCGGGCTCAAGACTGAGAATACCAACTCGAGTTGGTATTCTCAGTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013884.2-900s1c1
Sequence:CCGGGCTTGATTTGTATGATGACTTCTCGAGAAGTCATCATACAAATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013884
CSPG5 MISSION shRNA shRNA Plasmid DNA
chondroitin sulfate proteoglycan 5 (neuroglycan C)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013884.2-1837s1c1
Sequence:CCGGGCTTCTTGTAACCATTTGTTACTCGAGTAACAAATGGTTACAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013884.2-760s1c1
Sequence:CCGGGCCTCAGATATAATTGACATTCTCGAGAATGTCAATTATATCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013884.2-954s1c1
Sequence:CCGGCACATCCTTCTATGATGATTTCTCGAGAAATCATCATAGAAGGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013884.2-1494s1c1
Sequence:CCGGGCTCAAGACTGAGAATACCAACTCGAGTTGGTATTCTCAGTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013884.2-900s1c1
Sequence:CCGGGCTTGATTTGTATGATGACTTCTCGAGAAGTCATCATACAAATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013884
CSPG5 MISSION shRNA Lentiviral Transduction Particles
chondroitin sulfate proteoglycan 5 (neuroglycan C)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013884.2-1837s1c1
Sequence:CCGGGCTTCTTGTAACCATTTGTTACTCGAGTAACAAATGGTTACAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013884.2-760s1c1
Sequence:CCGGGCCTCAGATATAATTGACATTCTCGAGAATGTCAATTATATCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013884.2-954s1c1
Sequence:CCGGCACATCCTTCTATGATGATTTCTCGAGAAATCATCATAGAAGGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013884.2-1494s1c1
Sequence:CCGGGCTCAAGACTGAGAATACCAACTCGAGTTGGTATTCTCAGTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013884.2-900s1c1
Sequence:CCGGGCTTGATTTGTATGATGACTTCTCGAGAAGTCATCATACAAATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006574
CSPG5 MISSION shRNA Bacterial Glycerol Stock
chondroitin sulfate proteoglycan 5 (neuroglycan C)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006574.2-1134s1c1
Sequence:CCGGCTTCCCAAGTTACTGTCACAACTCGAGTTGTGACAGTAACTTGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006574.2-756s1c1
Sequence:CCGGGCTTGACTTATACGATGATTTCTCGAGAAATCATCGTATAAGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006574.2-1374s1c1
Sequence:CCGGGCTGCGTAGGACCAACAAATTCTCGAGAATTTGTTGGTCCTACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006574.2-1802s1c1
Sequence:CCGGGCAAAGAAACTGAACAGAATTCTCGAGAATTCTGTTCAGTTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006574.2-1597s1c1
Sequence:CCGGGTGAACTGTCTTCAGAATAATCTCGAGATTATTCTGAAGACAGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006574
CSPG5 MISSION shRNA shRNA Plasmid DNA
chondroitin sulfate proteoglycan 5 (neuroglycan C)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006574.2-1134s1c1
Sequence:CCGGCTTCCCAAGTTACTGTCACAACTCGAGTTGTGACAGTAACTTGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006574.2-756s1c1
Sequence:CCGGGCTTGACTTATACGATGATTTCTCGAGAAATCATCGTATAAGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006574.2-1374s1c1
Sequence:CCGGGCTGCGTAGGACCAACAAATTCTCGAGAATTTGTTGGTCCTACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006574.2-1802s1c1
Sequence:CCGGGCAAAGAAACTGAACAGAATTCTCGAGAATTCTGTTCAGTTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006574.2-1597s1c1
Sequence:CCGGGTGAACTGTCTTCAGAATAATCTCGAGATTATTCTGAAGACAGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006574
CSPG5 MISSION shRNA Lentiviral Transduction Particles
chondroitin sulfate proteoglycan 5 (neuroglycan C)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006574.2-1134s1c1
Sequence:CCGGCTTCCCAAGTTACTGTCACAACTCGAGTTGTGACAGTAACTTGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006574.2-756s1c1
Sequence:CCGGGCTTGACTTATACGATGATTTCTCGAGAAATCATCGTATAAGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006574.2-1374s1c1
Sequence:CCGGGCTGCGTAGGACCAACAAATTCTCGAGAATTTGTTGGTCCTACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006574.2-1802s1c1
Sequence:CCGGGCAAAGAAACTGAACAGAATTCTCGAGAATTCTGTTCAGTTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006574.2-1597s1c1
Sequence:CCGGGTGAACTGTCTTCAGAATAATCTCGAGATTATTCTGAAGACAGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks