EMAIL THIS PAGE TO A FRIEND

CSPP1

centrosome and spindle pole associated protein 1

96 Gene Product Result for
Synonyms: CSPP
UniProtKB ID: Q1MSJ5, A6ND63, Q70F00, Q8TBC1
Gene ID:
Human(79848) Summary: CSPP1 interacts with centrosomes and microtubules and plays a role in cell-cycle progression and spindle organization (Patzke et al., 2005 [PubMed 15580290]
Mouse(211660) centrosome and spindle pole associated protein 1
Rat(362472) centrosome and spindle pole associated protein 1
chicken(420169) centrosome and spindle pole associated protein 1
cow(524180) centrosome and spindle pole associated protein 1
Horse(100063345) centrosome and spindle pole associated protein 1
domestic cat(101092334) centrosome and spindle pole associated protein 1
dog(477902) centrosome and spindle pole associated protein 1
domestic guinea pig(100716608) centrosome and spindle pole associated protein 1
naked mole-rat(101709231) centrosome and spindle pole associated protein 1
sheep(101102495) centrosome and spindle pole associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301147 ANTI-CSPP1 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024790 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024790 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024790 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026493 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026493 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026493 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157731 MISSION® esiRNA esiRNA human CSPP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077204 Rosetta Predictions human pricing
NM_024790 Rosetta Predictions human pricing
XM_001060285 Rosetta Predictions rat pricing
XM_342793 Rosetta Predictions rat pricing
NM_026493 Rosetta Predictions mouse pricing
XM_129366 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312214 predicted 945
2 SASI_Hs02_00312215 predicted 3280
3 SASI_Hs02_00312216 predicted 1671
4 SASI_Hs02_00312217 predicted 1649
5 SASI_Hs02_00312218 predicted 3685
6 SASI_Hs02_00312219 predicted 3135
7 SASI_Hs02_00312220 predicted 1098
8 SASI_Hs02_00312221 predicted 1257
9 SASI_Hs02_00312222 predicted 1213
10 SASI_Hs02_00312223 predicted 1566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024790 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357338 predicted 835
2 SASI_Hs01_00050643 predicted 3174
3 SASI_Hs01_00050644 predicted 1562
4 SASI_Hs01_00050646 predicted 1540
5 SASI_Hs02_00357339 predicted 3580
6 SASI_Hs01_00050647 predicted 3031
7 SASI_Hs01_00050648 predicted 997
8 SASI_Hs02_00357340 predicted 1151
9 SASI_Hs01_00050649 predicted 1111
10 SASI_Hs01_00050650 predicted 1455
11 SASI_Hs01_00050642 predicted 3130
12 SASI_Hs01_00050645 predicted 3424
13 SASI_Hs01_00050651 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060285 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295908 predicted 2000
2 SASI_Rn02_00295909 predicted 2711
3 SASI_Rn02_00295910 predicted 2737
4 SASI_Rn02_00295911 predicted 2192
5 SASI_Rn02_00295912 predicted 2420
6 SASI_Rn02_00295913 predicted 230
7 SASI_Rn02_00295914 predicted 2343
8 SASI_Rn02_00295915 predicted 1928
9 SASI_Rn02_00295916 predicted 1885
10 SASI_Rn02_00295917 predicted 1977
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342793 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394821 predicted 1992
2 SASI_Rn02_00394822 predicted 2715
3 SASI_Rn02_00394823 predicted 2737
4 SASI_Rn02_00394824 predicted 2190
5 SASI_Rn02_00394825 predicted 2426
6 SASI_Rn02_00394826 predicted 228
7 SASI_Rn02_00394827 predicted 2345
8 SASI_Rn02_00394828 predicted 1929
9 SASI_Rn02_00394829 predicted 1881
10 SASI_Rn02_00394830 predicted 1976
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026493 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330373 predicted 471
2 SASI_Mm02_00330374 predicted 642
3 SASI_Mm02_00330375 predicted 3541
4 SASI_Mm02_00330376 predicted 3429
5 SASI_Mm02_00330377 predicted 398
6 SASI_Mm02_00330378 predicted 330
7 SASI_Mm02_00330379 predicted 1600
8 SASI_Mm02_00330380 predicted 225
9 SASI_Mm02_00330381 predicted 3508
10 SASI_Mm02_00330382 predicted 1333
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129366 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284047 predicted 428
2 SASI_Mm01_00284048 predicted 427
3 SASI_Mm01_00284049 predicted 450
4 SASI_Mm01_00284050 predicted 334
5 SASI_Mm01_00284051 predicted 444
6 SASI_Mm01_00284052 predicted 434
7 SASI_Mm01_00284053 predicted 434
8 SASI_Mm01_00284054 predicted 445
9 SASI_Mm01_00284055 predicted 329
10 SASI_Mm01_00284056 predicted 396
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024790
VALIDATED
CSPP1 MISSION shRNA Bacterial Glycerol Stock
centrosome and spindle pole associated protein 1
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024790.2-584s1c1
Sequence:CCGGGAAGAGGCTGAACAGAATAAACTCGAGTTTATTCTGTTCAGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024790.2-483s1c1
Sequence:CCGGGATTCAGAAACACGAGTTGATCTCGAGATCAACTCGTGTTTCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024790.2-106s1c1
Sequence:CCGGGCAAACTCCAAAGACCTCCTTCTCGAGAAGGAGGTCTTTGGAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024790.2-1011s1c1
Sequence:CCGGGATGACATCATGAAACACATACTCGAGTATGTGTTTCATGATGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024790.2-1035s1c1
Sequence:CCGGGATGACGGATCAAACTCTGTACTCGAGTACAGAGTTTGATCCGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024790.2-646s1c1
Sequence:CCGGGTGCTAAAGTACGAGAGCAAACTCGAGTTTGCTCTCGTACTTTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024790.2-922s1c1
Sequence:CCGGGAGTGAGAAATGAGGAACGAACTCGAGTTCGTTCCTCATTTCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024790.2-828s1c1
Sequence:CCGGCGGAAAGGACTAGACATTGATCTCGAGATCAATGTCTAGTCCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024790.2-636s1c1
Sequence:CCGGGCCATCCCAAGTGCTAAAGTACTCGAGTACTTTAGCACTTGGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024790.2-528s1c1
Sequence:CCGGCCAAGAGATCATCACACCTTACTCGAGTAAGGTGTGATGATCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024790.2-612s1c1
Sequence:CCGGGAAGGTGCCAAAGTTGACTTACTCGAGTAAGTCAACTTTGGCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024790.5-337s21c1
Sequence:CCGGAGGAATTGATTATGGATTAAGCTCGAGCTTAATCCATAATCAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024790.5-4137s21c1
Sequence:CCGGTGCAATCAAATGTCCTATTAACTCGAGTTAATAGGACATTTGATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024790.5-1297s21c1
Sequence:CCGGGAAATCGCCTGATAGACTAAACTCGAGTTTAGTCTATCAGGCGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024790.5-716s21c1
Sequence:CCGGCTAGATGATGAAATCGAATTACTCGAGTAATTCGATTTCATCATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024790.5-3029s21c1
Sequence:CCGGCCAAGAGATCATCACACCTTACTCGAGTAAGGTGTGATGATCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024790
VALIDATED
CSPP1 MISSION shRNA shRNA Plasmid DNA
centrosome and spindle pole associated protein 1
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024790.2-584s1c1
Sequence:CCGGGAAGAGGCTGAACAGAATAAACTCGAGTTTATTCTGTTCAGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024790.2-483s1c1
Sequence:CCGGGATTCAGAAACACGAGTTGATCTCGAGATCAACTCGTGTTTCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024790.2-106s1c1
Sequence:CCGGGCAAACTCCAAAGACCTCCTTCTCGAGAAGGAGGTCTTTGGAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024790.2-1011s1c1
Sequence:CCGGGATGACATCATGAAACACATACTCGAGTATGTGTTTCATGATGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024790.2-1035s1c1
Sequence:CCGGGATGACGGATCAAACTCTGTACTCGAGTACAGAGTTTGATCCGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024790.2-646s1c1
Sequence:CCGGGTGCTAAAGTACGAGAGCAAACTCGAGTTTGCTCTCGTACTTTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024790.2-922s1c1
Sequence:CCGGGAGTGAGAAATGAGGAACGAACTCGAGTTCGTTCCTCATTTCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024790.2-828s1c1
Sequence:CCGGCGGAAAGGACTAGACATTGATCTCGAGATCAATGTCTAGTCCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024790.2-636s1c1
Sequence:CCGGGCCATCCCAAGTGCTAAAGTACTCGAGTACTTTAGCACTTGGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024790.2-528s1c1
Sequence:CCGGCCAAGAGATCATCACACCTTACTCGAGTAAGGTGTGATGATCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024790.2-612s1c1
Sequence:CCGGGAAGGTGCCAAAGTTGACTTACTCGAGTAAGTCAACTTTGGCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024790.5-337s21c1
Sequence:CCGGAGGAATTGATTATGGATTAAGCTCGAGCTTAATCCATAATCAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024790.5-4137s21c1
Sequence:CCGGTGCAATCAAATGTCCTATTAACTCGAGTTAATAGGACATTTGATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024790.5-1297s21c1
Sequence:CCGGGAAATCGCCTGATAGACTAAACTCGAGTTTAGTCTATCAGGCGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024790.5-716s21c1
Sequence:CCGGCTAGATGATGAAATCGAATTACTCGAGTAATTCGATTTCATCATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024790.5-3029s21c1
Sequence:CCGGCCAAGAGATCATCACACCTTACTCGAGTAAGGTGTGATGATCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024790
VALIDATED
CSPP1 MISSION shRNA Lentiviral Transduction Particles
centrosome and spindle pole associated protein 1
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024790.2-584s1c1
Sequence:CCGGGAAGAGGCTGAACAGAATAAACTCGAGTTTATTCTGTTCAGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024790.2-483s1c1
Sequence:CCGGGATTCAGAAACACGAGTTGATCTCGAGATCAACTCGTGTTTCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024790.2-106s1c1
Sequence:CCGGGCAAACTCCAAAGACCTCCTTCTCGAGAAGGAGGTCTTTGGAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024790.2-1011s1c1
Sequence:CCGGGATGACATCATGAAACACATACTCGAGTATGTGTTTCATGATGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024790.2-1035s1c1
Sequence:CCGGGATGACGGATCAAACTCTGTACTCGAGTACAGAGTTTGATCCGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024790.2-646s1c1
Sequence:CCGGGTGCTAAAGTACGAGAGCAAACTCGAGTTTGCTCTCGTACTTTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024790.2-922s1c1
Sequence:CCGGGAGTGAGAAATGAGGAACGAACTCGAGTTCGTTCCTCATTTCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024790.2-828s1c1
Sequence:CCGGCGGAAAGGACTAGACATTGATCTCGAGATCAATGTCTAGTCCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024790.2-636s1c1
Sequence:CCGGGCCATCCCAAGTGCTAAAGTACTCGAGTACTTTAGCACTTGGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024790.2-528s1c1
Sequence:CCGGCCAAGAGATCATCACACCTTACTCGAGTAAGGTGTGATGATCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024790.2-612s1c1
Sequence:CCGGGAAGGTGCCAAAGTTGACTTACTCGAGTAAGTCAACTTTGGCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024790.5-337s21c1
Sequence:CCGGAGGAATTGATTATGGATTAAGCTCGAGCTTAATCCATAATCAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024790.5-4137s21c1
Sequence:CCGGTGCAATCAAATGTCCTATTAACTCGAGTTAATAGGACATTTGATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024790.5-1297s21c1
Sequence:CCGGGAAATCGCCTGATAGACTAAACTCGAGTTTAGTCTATCAGGCGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024790.5-716s21c1
Sequence:CCGGCTAGATGATGAAATCGAATTACTCGAGTAATTCGATTTCATCATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024790.5-3029s21c1
Sequence:CCGGCCAAGAGATCATCACACCTTACTCGAGTAAGGTGTGATGATCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026493
VALIDATED
CSPP1 MISSION shRNA Bacterial Glycerol Stock
centrosome and spindle pole associated protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026493.3-2888s21c1
Sequence:CCGGGAGGAACCCAATGGATATATTCTCGAGAATATATCCATTGGGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026493.3-1141s21c1
Sequence:CCGGTCGATATCACAAGTCCATTTGCTCGAGCAAATGGACTTGTGATATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026493.3-547s21c1
Sequence:CCGGACCGAGAATACAATCAGTTTCCTCGAGGAAACTGATTGTATTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026493.3-1606s21c1
Sequence:CCGGCTTACGATGATGCGTACTATTCTCGAGAATAGTACGCATCATCGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026493.3-3800s21c1
Sequence:CCGGCTTGCTTGTGGCCCTACTTTACTCGAGTAAAGTAGGGCCACAAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026493
VALIDATED
CSPP1 MISSION shRNA shRNA Plasmid DNA
centrosome and spindle pole associated protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026493.3-2888s21c1
Sequence:CCGGGAGGAACCCAATGGATATATTCTCGAGAATATATCCATTGGGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026493.3-1141s21c1
Sequence:CCGGTCGATATCACAAGTCCATTTGCTCGAGCAAATGGACTTGTGATATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026493.3-547s21c1
Sequence:CCGGACCGAGAATACAATCAGTTTCCTCGAGGAAACTGATTGTATTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026493.3-1606s21c1
Sequence:CCGGCTTACGATGATGCGTACTATTCTCGAGAATAGTACGCATCATCGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026493.3-3800s21c1
Sequence:CCGGCTTGCTTGTGGCCCTACTTTACTCGAGTAAAGTAGGGCCACAAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026493
VALIDATED
CSPP1 MISSION shRNA Lentiviral Transduction Particles
centrosome and spindle pole associated protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026493.3-2888s21c1
Sequence:CCGGGAGGAACCCAATGGATATATTCTCGAGAATATATCCATTGGGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026493.3-1141s21c1
Sequence:CCGGTCGATATCACAAGTCCATTTGCTCGAGCAAATGGACTTGTGATATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026493.3-547s21c1
Sequence:CCGGACCGAGAATACAATCAGTTTCCTCGAGGAAACTGATTGTATTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026493.3-1606s21c1
Sequence:CCGGCTTACGATGATGCGTACTATTCTCGAGAATAGTACGCATCATCGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026493.3-3800s21c1
Sequence:CCGGCTTGCTTGTGGCCCTACTTTACTCGAGTAAAGTAGGGCCACAAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks