EMAIL THIS PAGE TO A FRIEND

CSRNP1

cysteine-serine-rich nuclear protein 1

107 Gene Product Result for
Synonyms: AXUD1 CSRNP-1 FAM130B TAIP-3 URAX1
UniProtKB ID: Q96S65, Q69YY5
Gene ID:
Human(64651) Summary: This gene encodes a protein that localizes to the nucleus and expression of this gene is induced in response to elevated levels of axin. The Wnt signalling pathway, which is negatively regulated by axin, is important in axis formation in early development and impaired regulation of this signalling pathway is often involved in tumors. A decreased level of expression of this gene in tumors compared to the level of expression in their corresponding normal tissues suggests that this gene product has a tumor suppressor function. [provided by RefSeq, Jul 2008]
Mouse(215418) cysteine-serine-rich nuclear protein 1
Rat(363165) cysteine-serine-rich nuclear protein 1
chicken(420425) cysteine-serine-rich nuclear protein 1
dog(485596) cysteine-serine-rich nuclear protein 1
cow(515406) cysteine-serine-rich nuclear protein 1
domestic cat(101100149) cysteine-serine-rich nuclear protein 1
domestic guinea pig(100725008) cysteine-serine-rich nuclear protein 1
naked mole-rat(101708115) cysteine-serine-rich nuclear protein 1
sheep(101112518) cysteine-serine-rich nuclear protein 1
Domestic Rabbit(100354183) cysteine-serine-rich nuclear protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153287 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153287 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153287 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033027 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033027 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033027 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033027 Rosetta Predictions human pricing
NM_001108786 Rosetta Predictions rat pricing
NM_153287 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033027 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057989 predicted 1056
2 SASI_Hs01_00057991 predicted 1531
3 SASI_Hs01_00057992 predicted 1911
4 SASI_Hs01_00057993 predicted 1259
5 SASI_Hs01_00057994 predicted 1695
6 SASI_Hs02_00360711 predicted 635
7 SASI_Hs02_00360712 predicted 1264
8 SASI_Hs01_00057995 predicted 1619
9 SASI_Hs02_00360713 predicted 573
10 SASI_Hs01_00057996 predicted 1075
11 SASI_Hs01_00057990 predicted 1089
12 SASI_Hs01_00057997 predicted 1264
13 SASI_Hs01_00057998 predicted 1730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108786 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242055 predicted 939
2 SASI_Rn02_00242056 predicted 621
3 SASI_Rn02_00242057 predicted 800
4 SASI_Rn02_00242058 predicted 794
5 SASI_Rn02_00242059 predicted 1424
6 SASI_Rn02_00242060 predicted 1615
7 SASI_Rn02_00242061 predicted 724
8 SASI_Rn02_00242062 predicted 852
9 SASI_Rn02_00242063 predicted 965
10 SASI_Rn02_00242064 predicted 1650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153287 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053690 predicted 429
2 SASI_Mm01_00053691 predicted 410
3 SASI_Mm01_00053692 predicted 503
4 SASI_Mm01_00053693 predicted 1625
5 SASI_Mm01_00053694 predicted 296
6 SASI_Mm01_00053695 predicted 315
7 SASI_Mm01_00053696 predicted 1651
8 SASI_Mm01_00053698 predicted 474
9 SASI_Mm02_00343126 predicted 323
10 SASI_Mm02_00343127 predicted 2204
11 SASI_Mm01_00053697 predicted 765
12 SASI_Mm01_00053699 predicted 518
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153287
CSRNP1 MISSION shRNA Bacterial Glycerol Stock
cysteine-serine-rich nuclear protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153287.2-1231s1c1
Sequence:CCGGCCTGAATTTCAGTGACTCTGACTCGAGTCAGAGTCACTGAAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153287.3-1572s21c1
Sequence:CCGGTCCAGGCTCTGCCAGATTATACTCGAGTATAATCTGGCAGAGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215519    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153287.3-2376s1c1
Sequence:CCGGGTTTATGGCTGCTCTATTAAACTCGAGTTTAATAGAGCAGCCATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153287.3-1803s1c1
Sequence:CCGGCTGTGCCAGTGTAAGGATTAACTCGAGTTAATCCTTACACTGGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247193    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153287.3-2375s21c1
Sequence:CCGGAGTTTATGGCTGCTCTATTAACTCGAGTTAATAGAGCAGCCATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153287.3-1242s21c1
Sequence:CCGGGTGACTCTGACCTCGGAATTGCTCGAGCAATTCCGAGGTCAGAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153287.3-326s21c1
Sequence:CCGGGGCATCACCGTCTACTATTTCCTCGAGGAAATAGTAGACGGTGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153287.3-1804s21c1
Sequence:CCGGTGTGCCAGTGTAAGGATTAAGCTCGAGCTTAATCCTTACACTGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153287
CSRNP1 MISSION shRNA shRNA Plasmid DNA
cysteine-serine-rich nuclear protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153287.2-1231s1c1
Sequence:CCGGCCTGAATTTCAGTGACTCTGACTCGAGTCAGAGTCACTGAAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153287.3-1572s21c1
Sequence:CCGGTCCAGGCTCTGCCAGATTATACTCGAGTATAATCTGGCAGAGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215519    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153287.3-2376s1c1
Sequence:CCGGGTTTATGGCTGCTCTATTAAACTCGAGTTTAATAGAGCAGCCATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153287.3-1803s1c1
Sequence:CCGGCTGTGCCAGTGTAAGGATTAACTCGAGTTAATCCTTACACTGGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247193    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153287.3-2375s21c1
Sequence:CCGGAGTTTATGGCTGCTCTATTAACTCGAGTTAATAGAGCAGCCATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153287.3-1242s21c1
Sequence:CCGGGTGACTCTGACCTCGGAATTGCTCGAGCAATTCCGAGGTCAGAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153287.3-326s21c1
Sequence:CCGGGGCATCACCGTCTACTATTTCCTCGAGGAAATAGTAGACGGTGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153287.3-1804s21c1
Sequence:CCGGTGTGCCAGTGTAAGGATTAAGCTCGAGCTTAATCCTTACACTGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153287
CSRNP1 MISSION shRNA Lentiviral Transduction Particles
cysteine-serine-rich nuclear protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153287.2-1231s1c1
Sequence:CCGGCCTGAATTTCAGTGACTCTGACTCGAGTCAGAGTCACTGAAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153287.3-1572s21c1
Sequence:CCGGTCCAGGCTCTGCCAGATTATACTCGAGTATAATCTGGCAGAGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215519    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153287.3-2376s1c1
Sequence:CCGGGTTTATGGCTGCTCTATTAAACTCGAGTTTAATAGAGCAGCCATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153287.3-1803s1c1
Sequence:CCGGCTGTGCCAGTGTAAGGATTAACTCGAGTTAATCCTTACACTGGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247193    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153287.3-2375s21c1
Sequence:CCGGAGTTTATGGCTGCTCTATTAACTCGAGTTAATAGAGCAGCCATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153287.3-1242s21c1
Sequence:CCGGGTGACTCTGACCTCGGAATTGCTCGAGCAATTCCGAGGTCAGAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153287.3-326s21c1
Sequence:CCGGGGCATCACCGTCTACTATTTCCTCGAGGAAATAGTAGACGGTGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153287.3-1804s21c1
Sequence:CCGGTGTGCCAGTGTAAGGATTAAGCTCGAGCTTAATCCTTACACTGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033027
CSRNP1 MISSION shRNA Bacterial Glycerol Stock
cysteine-serine-rich nuclear protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033027.2-2401s1c1
Sequence:CCGGCCACTGGACTGTGAAGACTATCTCGAGATAGTCTTCACAGTCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033027.2-1085s1c1
Sequence:CCGGCCCATTTCATCCACACACTCACTCGAGTGAGTGTGTGGATGAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033027.2-577s1c1
Sequence:CCGGCGCTTCTCTTTGGCTGAGTTTCTCGAGAAACTCAGCCAAAGAGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033027.2-2311s1c1
Sequence:CCGGCGTGATGTTCCTTAGCCCAAACTCGAGTTTGGGCTAAGGAACATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033027.2-1398s1c1
Sequence:CCGGGAGTTTCAGTGACTCTGACTTCTCGAGAAGTCAGAGTCACTGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134979    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033027.2-3021s1c1
Sequence:CCGGCCTGAGTGTCAGAACTATAATCTCGAGATTATAGTTCTGACACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135337    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033027.2-3020s1c1
Sequence:CCGGCCCTGAGTGTCAGAACTATAACTCGAGTTATAGTTCTGACACTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033027.2-1489s1c1
Sequence:CCGGGCTGACATCTTTGGTACTAGTCTCGAGACTAGTACCAAAGATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033027.2-1707s1c1
Sequence:CCGGCTTGTCTTCTTGTGACTCCTTCTCGAGAAGGAGTCACAAGAAGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033027.2-1259s1c1
Sequence:CCGGGCAGCGACATGACTGATTCTTCTCGAGAAGAATCAGTCATGTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033027.2-1905s1c1
Sequence:CCGGCGAAGCCCTAGATCCCTTTATCTCGAGATAAAGGGATCTAGGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033027.2-2869s1c1
Sequence:CCGGCCAGACTATTATCTCAGGGCTCTCGAGAGCCCTGAGATAATAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033027
CSRNP1 MISSION shRNA shRNA Plasmid DNA
cysteine-serine-rich nuclear protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033027.2-2401s1c1
Sequence:CCGGCCACTGGACTGTGAAGACTATCTCGAGATAGTCTTCACAGTCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033027.2-1085s1c1
Sequence:CCGGCCCATTTCATCCACACACTCACTCGAGTGAGTGTGTGGATGAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033027.2-577s1c1
Sequence:CCGGCGCTTCTCTTTGGCTGAGTTTCTCGAGAAACTCAGCCAAAGAGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033027.2-2311s1c1
Sequence:CCGGCGTGATGTTCCTTAGCCCAAACTCGAGTTTGGGCTAAGGAACATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033027.2-1398s1c1
Sequence:CCGGGAGTTTCAGTGACTCTGACTTCTCGAGAAGTCAGAGTCACTGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134979    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033027.2-3021s1c1
Sequence:CCGGCCTGAGTGTCAGAACTATAATCTCGAGATTATAGTTCTGACACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135337    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033027.2-3020s1c1
Sequence:CCGGCCCTGAGTGTCAGAACTATAACTCGAGTTATAGTTCTGACACTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033027.2-1489s1c1
Sequence:CCGGGCTGACATCTTTGGTACTAGTCTCGAGACTAGTACCAAAGATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033027.2-1707s1c1
Sequence:CCGGCTTGTCTTCTTGTGACTCCTTCTCGAGAAGGAGTCACAAGAAGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033027.2-1259s1c1
Sequence:CCGGGCAGCGACATGACTGATTCTTCTCGAGAAGAATCAGTCATGTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033027.2-1905s1c1
Sequence:CCGGCGAAGCCCTAGATCCCTTTATCTCGAGATAAAGGGATCTAGGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033027.2-2869s1c1
Sequence:CCGGCCAGACTATTATCTCAGGGCTCTCGAGAGCCCTGAGATAATAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033027
CSRNP1 MISSION shRNA Lentiviral Transduction Particles
cysteine-serine-rich nuclear protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033027.2-2401s1c1
Sequence:CCGGCCACTGGACTGTGAAGACTATCTCGAGATAGTCTTCACAGTCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033027.2-1085s1c1
Sequence:CCGGCCCATTTCATCCACACACTCACTCGAGTGAGTGTGTGGATGAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033027.2-577s1c1
Sequence:CCGGCGCTTCTCTTTGGCTGAGTTTCTCGAGAAACTCAGCCAAAGAGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033027.2-2311s1c1
Sequence:CCGGCGTGATGTTCCTTAGCCCAAACTCGAGTTTGGGCTAAGGAACATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033027.2-1398s1c1
Sequence:CCGGGAGTTTCAGTGACTCTGACTTCTCGAGAAGTCAGAGTCACTGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134979    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033027.2-3021s1c1
Sequence:CCGGCCTGAGTGTCAGAACTATAATCTCGAGATTATAGTTCTGACACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135337    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033027.2-3020s1c1
Sequence:CCGGCCCTGAGTGTCAGAACTATAACTCGAGTTATAGTTCTGACACTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033027.2-1489s1c1
Sequence:CCGGGCTGACATCTTTGGTACTAGTCTCGAGACTAGTACCAAAGATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033027.2-1707s1c1
Sequence:CCGGCTTGTCTTCTTGTGACTCCTTCTCGAGAAGGAGTCACAAGAAGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033027.2-1259s1c1
Sequence:CCGGGCAGCGACATGACTGATTCTTCTCGAGAAGAATCAGTCATGTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033027.2-1905s1c1
Sequence:CCGGCGAAGCCCTAGATCCCTTTATCTCGAGATAAAGGGATCTAGGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033027.2-2869s1c1
Sequence:CCGGCCAGACTATTATCTCAGGGCTCTCGAGAGCCCTGAGATAATAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks