EMAIL THIS PAGE TO A FRIEND

CSRNP2

cysteine-serine-rich nuclear protein 2

179 Gene Product Result for
Synonyms: C12orf2 C12orf22 FAM130A1 PPP1R72 TAIP-12
UniProtKB ID: Q9H175
Gene ID:
Human(81566) Summary: The protein encoded by this gene belongs to the CSRNP family of nuclear proteins that share conserved regions, including cysteine- and serine- rich regions, a basic domain, a transcriptional activation domain, and bind the sequence 'AGAGTG', thus have the hallmark of transcription factors. Studies in mice suggest that these genes may have redundant functions. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(207785) cysteine-serine-rich nuclear protein 2
Rat(315308) cysteine-serine-rich nuclear protein 2
Zebrafish(100003989) cysteine-serine-rich nuclear protein 2
cow(516929) cysteine-serine-rich nuclear protein 2
Horse(100052444) cysteine-serine-rich nuclear protein 2
domestic cat(101090528) cysteine-serine-rich nuclear protein 2
dog(486541) cysteine-serine-rich nuclear protein 2
chicken(100859835) cysteine-serine-rich nuclear protein 2
sheep(101116301) cysteine-serine-rich nuclear protein 2
Domestic Rabbit(100346959) cysteine-serine-rich nuclear protein 2
naked mole-rat(101721789) cysteine-serine-rich nuclear protein 2
domestic guinea pig(100718517) cysteine-serine-rich nuclear protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030809 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030809 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030809 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153407 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153407 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153407 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030809 Rosetta Predictions human pricing
NM_001108113 Rosetta Predictions rat pricing
NM_153407 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183080 predicted 870
2 SASI_Hs01_00183081 predicted 490
3 SASI_Hs02_00358383 predicted 351
4 SASI_Hs01_00183082 predicted 312
5 SASI_Hs01_00183083 predicted 492
6 SASI_Hs01_00183084 predicted 932
7 SASI_Hs01_00183085 predicted 1062
8 SASI_Hs01_00183086 predicted 329
9 SASI_Hs01_00183088 predicted 675
10 SASI_Hs01_00183089 predicted 1739
11 SASI_Hs01_00183087 predicted 881
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108113 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235484 predicted 731
2 SASI_Rn02_00235485 predicted 699
3 SASI_Rn02_00235486 predicted 2154
4 SASI_Rn02_00235487 predicted 1248
5 SASI_Rn02_00235488 predicted 2157
6 SASI_Rn02_00235489 predicted 1340
7 SASI_Rn02_00235490 predicted 744
8 SASI_Rn02_00235491 predicted 1307
9 SASI_Rn02_00235492 predicted 2247
10 SASI_Rn02_00235493 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153407 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103665 predicted 363
2 SASI_Mm01_00103666 predicted 2125
3 SASI_Mm01_00103667 predicted 469
4 SASI_Mm01_00103668 predicted 1998
5 SASI_Mm01_00103669 predicted 1485
6 SASI_Mm01_00103670 predicted 1897
7 SASI_Mm01_00103671 predicted 1084
8 SASI_Mm01_00103672 predicted 1864
9 SASI_Mm01_00103673 predicted 480
10 SASI_Mm01_00103674 predicted 1801
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030809
VALIDATED
CSRNP2 MISSION shRNA Bacterial Glycerol Stock
cysteine-serine-rich nuclear protein 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030809.1-1500s21c1
Sequence:CCGGCAACTGCCTCAACGGTGAACACTCGAGTGTTCACCGTTGAGGCAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030809.1-980s21c1
Sequence:CCGGTGCAGCCAGGCTGGGATTAAACTCGAGTTTAATCCCAGCCTGGCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030809.1-507s21c1
Sequence:CCGGAGGTGACTGTATACTACTTTGCTCGAGCAAAGTAGTATACAGTCACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030809.1-755s21c1
Sequence:CCGGACGCTGGATGATGTGTCAGATCTCGAGATCTGACACATCATCCAGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030809.1-454s21c1
Sequence:CCGGATCCATCCTGAAGCGGCAGAACTCGAGTTCTGCCGCTTCAGGATGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030809.1-342s21c1
Sequence:CCGGATGTGGATGTGGGCTCATCAGCTCGAGCTGATGAGCCCACATCCACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030809.1-2340s21c1
Sequence:CCGGGGTTATTCTGATATCCCATTTCTCGAGAAATGGGATATCAGAATAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030809.1-1061s1c1
Sequence:CCGGGCAGGACGCATTGAATTTAATCTCGAGATTAAATTCAATGCGTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030809.1-607s1c1
Sequence:CCGGGAGCTATACACTCTGTGAGTTCTCGAGAACTCACAGAGTGTATAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030809.1-1096s1c1
Sequence:CCGGGACTCATTACCTCCACACCATCTCGAGATGGTGTGGAGGTAATGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030809.1-950s1c1
Sequence:CCGGCGACTGTATTGTGACCCAGAACTCGAGTTCTGGGTCACAATACAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147489    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030809.1-3156s1c1
Sequence:CCGGGCGTATAGAATGGAACTCATTCTCGAGAATGAGTTCCATTCTATACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030809
VALIDATED
CSRNP2 MISSION shRNA shRNA Plasmid DNA
cysteine-serine-rich nuclear protein 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030809.1-1500s21c1
Sequence:CCGGCAACTGCCTCAACGGTGAACACTCGAGTGTTCACCGTTGAGGCAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030809.1-980s21c1
Sequence:CCGGTGCAGCCAGGCTGGGATTAAACTCGAGTTTAATCCCAGCCTGGCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030809.1-507s21c1
Sequence:CCGGAGGTGACTGTATACTACTTTGCTCGAGCAAAGTAGTATACAGTCACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030809.1-755s21c1
Sequence:CCGGACGCTGGATGATGTGTCAGATCTCGAGATCTGACACATCATCCAGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030809.1-454s21c1
Sequence:CCGGATCCATCCTGAAGCGGCAGAACTCGAGTTCTGCCGCTTCAGGATGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030809.1-342s21c1
Sequence:CCGGATGTGGATGTGGGCTCATCAGCTCGAGCTGATGAGCCCACATCCACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030809.1-2340s21c1
Sequence:CCGGGGTTATTCTGATATCCCATTTCTCGAGAAATGGGATATCAGAATAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030809.1-1061s1c1
Sequence:CCGGGCAGGACGCATTGAATTTAATCTCGAGATTAAATTCAATGCGTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030809.1-607s1c1
Sequence:CCGGGAGCTATACACTCTGTGAGTTCTCGAGAACTCACAGAGTGTATAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030809.1-1096s1c1
Sequence:CCGGGACTCATTACCTCCACACCATCTCGAGATGGTGTGGAGGTAATGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030809.1-950s1c1
Sequence:CCGGCGACTGTATTGTGACCCAGAACTCGAGTTCTGGGTCACAATACAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147489    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030809.1-3156s1c1
Sequence:CCGGGCGTATAGAATGGAACTCATTCTCGAGAATGAGTTCCATTCTATACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030809
VALIDATED
CSRNP2 MISSION shRNA Lentiviral Transduction Particles
cysteine-serine-rich nuclear protein 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030809.1-1500s21c1
Sequence:CCGGCAACTGCCTCAACGGTGAACACTCGAGTGTTCACCGTTGAGGCAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030809.1-980s21c1
Sequence:CCGGTGCAGCCAGGCTGGGATTAAACTCGAGTTTAATCCCAGCCTGGCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030809.1-507s21c1
Sequence:CCGGAGGTGACTGTATACTACTTTGCTCGAGCAAAGTAGTATACAGTCACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030809.1-755s21c1
Sequence:CCGGACGCTGGATGATGTGTCAGATCTCGAGATCTGACACATCATCCAGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030809.1-454s21c1
Sequence:CCGGATCCATCCTGAAGCGGCAGAACTCGAGTTCTGCCGCTTCAGGATGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030809.1-342s21c1
Sequence:CCGGATGTGGATGTGGGCTCATCAGCTCGAGCTGATGAGCCCACATCCACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030809.1-2340s21c1
Sequence:CCGGGGTTATTCTGATATCCCATTTCTCGAGAAATGGGATATCAGAATAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030809.1-1061s1c1
Sequence:CCGGGCAGGACGCATTGAATTTAATCTCGAGATTAAATTCAATGCGTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030809.1-607s1c1
Sequence:CCGGGAGCTATACACTCTGTGAGTTCTCGAGAACTCACAGAGTGTATAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030809.1-1096s1c1
Sequence:CCGGGACTCATTACCTCCACACCATCTCGAGATGGTGTGGAGGTAATGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030809.1-950s1c1
Sequence:CCGGCGACTGTATTGTGACCCAGAACTCGAGTTCTGGGTCACAATACAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147489    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030809.1-3156s1c1
Sequence:CCGGGCGTATAGAATGGAACTCATTCTCGAGAATGAGTTCCATTCTATACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153407
VALIDATED
CSRNP2 MISSION shRNA Bacterial Glycerol Stock
cysteine-serine-rich nuclear protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153407.1-1488s1c1
Sequence:CCGGCCGTCTTACTTGAACAGTGGACTCGAGTCCACTGTTCAAGTAAGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153407.1-3783s1c1
Sequence:CCGGGCGTTGACAATGTCAAGCAAACTCGAGTTTGCTTGACATTGTCAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153407.1-434s1c1
Sequence:CCGGCACACCAACATCCATCCTGAACTCGAGTTCAGGATGGATGTTGGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153407.1-1202s1c1
Sequence:CCGGCCAGGAGTTCATCGCCGAGAACTCGAGTTCTCGGCGATGAACTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153407.1-581s1c1
Sequence:CCGGCCATAACTCTGTACGCAGCTACTCGAGTAGCTGCGTACAGAGTTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153407
VALIDATED
CSRNP2 MISSION shRNA shRNA Plasmid DNA
cysteine-serine-rich nuclear protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153407.1-1488s1c1
Sequence:CCGGCCGTCTTACTTGAACAGTGGACTCGAGTCCACTGTTCAAGTAAGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153407.1-3783s1c1
Sequence:CCGGGCGTTGACAATGTCAAGCAAACTCGAGTTTGCTTGACATTGTCAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153407.1-434s1c1
Sequence:CCGGCACACCAACATCCATCCTGAACTCGAGTTCAGGATGGATGTTGGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153407.1-1202s1c1
Sequence:CCGGCCAGGAGTTCATCGCCGAGAACTCGAGTTCTCGGCGATGAACTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153407.1-581s1c1
Sequence:CCGGCCATAACTCTGTACGCAGCTACTCGAGTAGCTGCGTACAGAGTTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153407
VALIDATED
CSRNP2 MISSION shRNA Lentiviral Transduction Particles
cysteine-serine-rich nuclear protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153407.1-1488s1c1
Sequence:CCGGCCGTCTTACTTGAACAGTGGACTCGAGTCCACTGTTCAAGTAAGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153407.1-3783s1c1
Sequence:CCGGGCGTTGACAATGTCAAGCAAACTCGAGTTTGCTTGACATTGTCAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153407.1-434s1c1
Sequence:CCGGCACACCAACATCCATCCTGAACTCGAGTTCAGGATGGATGTTGGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153407.1-1202s1c1
Sequence:CCGGCCAGGAGTTCATCGCCGAGAACTCGAGTTCTCGGCGATGAACTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153407.1-581s1c1
Sequence:CCGGCCATAACTCTGTACGCAGCTACTCGAGTAGCTGCGTACAGAGTTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)