EMAIL THIS PAGE TO A FRIEND

CSRNP3

cysteine-serine-rich nuclear protein 3

136 Gene Product Result for
Synonyms: FAM130A2 PPP1R73 TAIP-2 TAIP2
UniProtKB ID: Q8WYN3, B3KPR4, Q53SG0, Q6ZTX3, Q9HAF9
Gene ID:
Mouse(77771) cysteine-serine-rich nuclear protein 3
Rat(311093) cysteine-serine-rich nuclear protein 3
domestic guinea pig(100716409) cysteine-serine-rich nuclear protein 3
naked mole-rat(101708588) cysteine-serine-rich nuclear protein 3
sheep(101109781) cysteine-serine-rich nuclear protein 3
chicken(772101) cysteine-serine-rich nuclear protein 3
dog(100682811) cysteine-serine-rich nuclear protein 3
Horse(100051877) cysteine-serine-rich nuclear protein 3
cow(540832) cysteine-serine-rich nuclear protein 3
domestic cat(101081068) cysteine-serine-rich nuclear protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153409 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153409 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153409 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024969 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024969 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024969 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024969 Rosetta Predictions human pricing
XM_001056212 Rosetta Predictions rat pricing
XM_229993 Rosetta Predictions rat pricing
NM_153409 Rosetta Predictions mouse pricing
NM_178634 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073923 predicted 455
2 SASI_Hs01_00073924 predicted 1994
3 SASI_Hs01_00073925 predicted 1790
4 SASI_Hs01_00073926 predicted 1017
5 SASI_Hs01_00073927 predicted 1889
6 SASI_Hs01_00073928 predicted 1954
7 SASI_Hs01_00073929 predicted 367
8 SASI_Hs01_00073930 predicted 955
9 SASI_Hs01_00073931 predicted 1821
10 SASI_Hs02_00357634 predicted 2060
11 SASI_Hs01_00073932 predicted 665
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056212 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282458 predicted 2703
2 SASI_Rn02_00282459 predicted 1849
3 SASI_Rn02_00282460 predicted 2472
4 SASI_Rn02_00282461 predicted 2677
5 SASI_Rn02_00282462 predicted 1876
6 SASI_Rn02_00282463 predicted 1188
7 SASI_Rn02_00282464 predicted 1583
8 SASI_Rn02_00282465 predicted 1771
9 SASI_Rn02_00282466 predicted 1398
10 SASI_Rn02_00282467 predicted 2821
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_229993 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386062 predicted 2695
2 SASI_Rn02_00386063 predicted 1846
3 SASI_Rn02_00386064 predicted 2474
4 SASI_Rn02_00386065 predicted 2679
5 SASI_Rn02_00386066 predicted 1874
6 SASI_Rn02_00386067 predicted 1190
7 SASI_Rn02_00386068 predicted 1587
8 SASI_Rn02_00386069 predicted 1763
9 SASI_Rn02_00386070 predicted 1404
10 SASI_Rn02_00386071 predicted 2814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153409 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182861 predicted 2006
2 SASI_Mm01_00182862 predicted 2018
3 SASI_Mm01_00182863 predicted 796
4 SASI_Mm01_00182864 predicted 1740
5 SASI_Mm01_00182865 predicted 2067
6 SASI_Mm01_00182866 predicted 1124
7 SASI_Mm01_00182867 predicted 798
8 SASI_Mm01_00182868 predicted 855
9 SASI_Mm01_00182869 predicted 771
10 SASI_Mm01_00182870 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178634 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349012 predicted 1852
2 SASI_Mm02_00349013 predicted 1860
3 SASI_Mm02_00349014 predicted 639
4 SASI_Mm02_00349015 predicted 1578
5 SASI_Mm02_00349016 predicted 1907
6 SASI_Mm02_00349017 predicted 956
7 SASI_Mm02_00349018 predicted 637
8 SASI_Mm02_00349019 predicted 687
9 SASI_Mm02_00349020 predicted 605
10 SASI_Mm02_00349021 predicted 605
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153409
CSRNP3 MISSION shRNA Bacterial Glycerol Stock
cysteine-serine-rich nuclear protein 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153409.2-1052s1c1
Sequence:CCGGCACTAAAGAAGGCTGTAGTAACTCGAGTTACTACAGCCTTCTTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193381    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153409.2-2107s1c1
Sequence:CCGGCTTCTATTTAAGGCACTGTATCTCGAGATACAGTGCCTTAAATAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153409.4-2208s21c1
Sequence:CCGGTGCTGGGCTCATCGTTGTTTACTCGAGTAAACAACGATGAGCCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153409.4-840s21c1
Sequence:CCGGCCCTGACCGTGGATGACATTTCTCGAGAAATGTCATCCACGGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153409.4-1174s21c1
Sequence:CCGGTATCCGTGTCCGGACTCATTTCTCGAGAAATGAGTCCGGACACGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153409.4-883s21c1
Sequence:CCGGCAACACCGAAGTGGACGAATACTCGAGTATTCGTCCACTTCGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153409.4-1329s21c1
Sequence:CCGGTCGCAGACAATTTCGAGATTGCTCGAGCAATCTCGAAATTGTCTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153409
CSRNP3 MISSION shRNA shRNA Plasmid DNA
cysteine-serine-rich nuclear protein 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153409.2-1052s1c1
Sequence:CCGGCACTAAAGAAGGCTGTAGTAACTCGAGTTACTACAGCCTTCTTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193381    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153409.2-2107s1c1
Sequence:CCGGCTTCTATTTAAGGCACTGTATCTCGAGATACAGTGCCTTAAATAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153409.4-2208s21c1
Sequence:CCGGTGCTGGGCTCATCGTTGTTTACTCGAGTAAACAACGATGAGCCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153409.4-840s21c1
Sequence:CCGGCCCTGACCGTGGATGACATTTCTCGAGAAATGTCATCCACGGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153409.4-1174s21c1
Sequence:CCGGTATCCGTGTCCGGACTCATTTCTCGAGAAATGAGTCCGGACACGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153409.4-883s21c1
Sequence:CCGGCAACACCGAAGTGGACGAATACTCGAGTATTCGTCCACTTCGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153409.4-1329s21c1
Sequence:CCGGTCGCAGACAATTTCGAGATTGCTCGAGCAATCTCGAAATTGTCTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153409
CSRNP3 MISSION shRNA Lentiviral Transduction Particles
cysteine-serine-rich nuclear protein 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153409.2-1052s1c1
Sequence:CCGGCACTAAAGAAGGCTGTAGTAACTCGAGTTACTACAGCCTTCTTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193381    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153409.2-2107s1c1
Sequence:CCGGCTTCTATTTAAGGCACTGTATCTCGAGATACAGTGCCTTAAATAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153409.4-2208s21c1
Sequence:CCGGTGCTGGGCTCATCGTTGTTTACTCGAGTAAACAACGATGAGCCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153409.4-840s21c1
Sequence:CCGGCCCTGACCGTGGATGACATTTCTCGAGAAATGTCATCCACGGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153409.4-1174s21c1
Sequence:CCGGTATCCGTGTCCGGACTCATTTCTCGAGAAATGAGTCCGGACACGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153409.4-883s21c1
Sequence:CCGGCAACACCGAAGTGGACGAATACTCGAGTATTCGTCCACTTCGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153409.4-1329s21c1
Sequence:CCGGTCGCAGACAATTTCGAGATTGCTCGAGCAATCTCGAAATTGTCTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024969
CSRNP3 MISSION shRNA Bacterial Glycerol Stock
cysteine-serine-rich nuclear protein 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024969.2-763s1c1
Sequence:CCGGGTACTTCTTCCTACAACCTTTCTCGAGAAAGGTTGTAGGAAGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024969.2-984s1c1
Sequence:CCGGGCTGCACTAAAGAAGGATGTACTCGAGTACATCCTTCTTTAGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024969.2-2582s1c1
Sequence:CCGGGCATCTGGAATCCATTCACATCTCGAGATGTGAATGGATTCCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024969.2-1790s1c1
Sequence:CCGGGTGCCCTGCAATAGTTTATATCTCGAGATATAAACTATTGCAGGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128096    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024969.2-2522s1c1
Sequence:CCGGCGCATGTTCATTCAAGCTGAACTCGAGTTCAGCTTGAATGAACATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024969.2-1673s1c1
Sequence:CCGGCCGGAGCAATTCGTTGACTATCTCGAGATAGTCAACGAATTGCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024969.2-428s1c1
Sequence:CCGGCGACTGAGGACAAAGAATGTACTCGAGTACATTCTTTGTCCTCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024969.3-2052s21c1
Sequence:CCGGGACCAACTCTTCTCTTATTTACTCGAGTAAATAAGAGAAGAGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024969.3-2327s21c1
Sequence:CCGGGTAGATCAGAGCTCCAAATTTCTCGAGAAATTTGGAGCTCTGATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024969
CSRNP3 MISSION shRNA shRNA Plasmid DNA
cysteine-serine-rich nuclear protein 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024969.2-763s1c1
Sequence:CCGGGTACTTCTTCCTACAACCTTTCTCGAGAAAGGTTGTAGGAAGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024969.2-984s1c1
Sequence:CCGGGCTGCACTAAAGAAGGATGTACTCGAGTACATCCTTCTTTAGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024969.2-2582s1c1
Sequence:CCGGGCATCTGGAATCCATTCACATCTCGAGATGTGAATGGATTCCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024969.2-1790s1c1
Sequence:CCGGGTGCCCTGCAATAGTTTATATCTCGAGATATAAACTATTGCAGGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128096    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024969.2-2522s1c1
Sequence:CCGGCGCATGTTCATTCAAGCTGAACTCGAGTTCAGCTTGAATGAACATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024969.2-1673s1c1
Sequence:CCGGCCGGAGCAATTCGTTGACTATCTCGAGATAGTCAACGAATTGCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024969.2-428s1c1
Sequence:CCGGCGACTGAGGACAAAGAATGTACTCGAGTACATTCTTTGTCCTCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024969.3-2052s21c1
Sequence:CCGGGACCAACTCTTCTCTTATTTACTCGAGTAAATAAGAGAAGAGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024969.3-2327s21c1
Sequence:CCGGGTAGATCAGAGCTCCAAATTTCTCGAGAAATTTGGAGCTCTGATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024969
CSRNP3 MISSION shRNA Lentiviral Transduction Particles
cysteine-serine-rich nuclear protein 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024969.2-763s1c1
Sequence:CCGGGTACTTCTTCCTACAACCTTTCTCGAGAAAGGTTGTAGGAAGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024969.2-984s1c1
Sequence:CCGGGCTGCACTAAAGAAGGATGTACTCGAGTACATCCTTCTTTAGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024969.2-2582s1c1
Sequence:CCGGGCATCTGGAATCCATTCACATCTCGAGATGTGAATGGATTCCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024969.2-1790s1c1
Sequence:CCGGGTGCCCTGCAATAGTTTATATCTCGAGATATAAACTATTGCAGGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128096    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024969.2-2522s1c1
Sequence:CCGGCGCATGTTCATTCAAGCTGAACTCGAGTTCAGCTTGAATGAACATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024969.2-1673s1c1
Sequence:CCGGCCGGAGCAATTCGTTGACTATCTCGAGATAGTCAACGAATTGCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024969.2-428s1c1
Sequence:CCGGCGACTGAGGACAAAGAATGTACTCGAGTACATTCTTTGTCCTCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024969.3-2052s21c1
Sequence:CCGGGACCAACTCTTCTCTTATTTACTCGAGTAAATAAGAGAAGAGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024969.3-2327s21c1
Sequence:CCGGGTAGATCAGAGCTCCAAATTTCTCGAGAAATTTGGAGCTCTGATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks