EMAIL THIS PAGE TO A FRIEND

CSRP1

cysteine and glycine-rich protein 1

58 Gene Product Result for
Synonyms: CRP CRP1 CSRP CYRP D1S181E
UniProtKB ID: P21291
Gene ID:
Human(1465) Summary: This gene encodes a member of the cysteine-rich protein (CSRP) family. This gene family includes a group of LIM domain proteins, which may be involved in regulatory processes important for development and cellular differentiation. The LIM/double zinc-finger motif found in this gene product occurs in proteins with critical functions in gene regulation, cell growth, and somatic differentiation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2010]
Mouse(13007) cysteine and glycine-rich protein 1
Rat(29276) cysteine and glycine-rich protein 1
chicken(396176) cysteine and glycine-rich protein 1
cow(615329) cysteine and glycine-rich protein 1
dog(607054) cysteine and glycine-rich protein 1
domestic cat(101096440) cysteine and glycine-rich protein 1
naked mole-rat(101720035) cysteine and glycine-rich protein 1
domestic guinea pig(100732962) cysteine and glycine-rich protein 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007791 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007791 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007791 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004078 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004078 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004078 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004078 Rosetta Predictions human pricing
NM_017148 Rosetta Predictions rat pricing
NM_007791 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133285 predicted 471
2 SASI_Hs01_00133287 predicted 222
3 SASI_Hs01_00133288 predicted 546
4 SASI_Hs02_00336873 predicted 537
5 SASI_Hs01_00133293 predicted 523
6 SASI_Hs02_00336874 predicted 216
7 SASI_Hs02_00336875 predicted 467
8 SASI_Hs02_00336876 predicted 536
9 SASI_Hs01_00133284 predicted 371
10 SASI_Hs01_00133291 predicted 474
11 SASI_Hs01_00133286 predicted 772
12 SASI_Hs01_00133289 predicted 686
13 SASI_Hs01_00133290 predicted 704
14 SASI_Hs01_00133292 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017148 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080409 predicted 734
2 SASI_Rn01_00080410 predicted 1012
3 SASI_Rn01_00080411 predicted 687
4 SASI_Rn01_00080413 predicted 450
5 SASI_Rn02_00261418 predicted 1007
6 SASI_Rn01_00080414 predicted 198
7 SASI_Rn01_00080415 predicted 634
8 SASI_Rn01_00080416 predicted 409
9 SASI_Rn01_00080417 predicted 528
10 SASI_Rn02_00261419 predicted 510
11 SASI_Rn01_00080412 predicted 353
12 SASI_Rn01_00080418 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007791 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075913 predicted 452
2 SASI_Mm01_00075914 predicted 261
3 SASI_Mm01_00075915 predicted 862
4 SASI_Mm01_00075916 predicted 390
5 SASI_Mm01_00075917 predicted 235
6 SASI_Mm01_00075918 predicted 495
7 SASI_Mm01_00075919 predicted 561
8 SASI_Mm01_00075921 predicted 1106
9 SASI_Mm01_00075922 predicted 1086
10 SASI_Mm02_00312480 predicted 962
11 SASI_Mm01_00075920 predicted 562
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007791
VALIDATED
CSRP1 MISSION shRNA Bacterial Glycerol Stock
cysteine and glycine-rich protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007791.5-155s21c2
Sequence:CCGGGAGGGCAACAGCTTCCATAAACTCGAGTTTATGGAAGCTGTTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007791.5-577s21c2
Sequence:CCGGCTGTAAAGGATGCTATGCCAACTCGAGTTGGCATAGCATCCTTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007791.5-394s21c3
Sequence:CCGGTGCATCCAAGTTTGCCCAGAACTCGAGTTCTGGGCAAACTTGGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007791.5-253s21c1
Sequence:CCGGCAAGTCATGTTACGGCAAGAACTCGAGTTCTTGCCGTAACATGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007791.5-993s21c2
Sequence:CCGGCCCACATCTTTGGAGACCAATCTCGAGATTGGTCTCCAAAGATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007791.2-993s1c1
Sequence:CCGGCCCACATCTTTGGAGACCAATCTCGAGATTGGTCTCCAAAGATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007791.2-155s1c1
Sequence:CCGGGAGGGCAACAGCTTCCATAAACTCGAGTTTATGGAAGCTGTTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007791.2-253s1c1
Sequence:CCGGCAAGTCATGTTACGGCAAGAACTCGAGTTCTTGCCGTAACATGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007791.2-577s1c1
Sequence:CCGGCTGTAAAGGATGCTATGCCAACTCGAGTTGGCATAGCATCCTTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007791.2-394s1c1
Sequence:CCGGTGCATCCAAGTTTGCCCAGAACTCGAGTTCTGGGCAAACTTGGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007791
VALIDATED
CSRP1 MISSION shRNA shRNA Plasmid DNA
cysteine and glycine-rich protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007791.5-155s21c2
Sequence:CCGGGAGGGCAACAGCTTCCATAAACTCGAGTTTATGGAAGCTGTTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007791.5-577s21c2
Sequence:CCGGCTGTAAAGGATGCTATGCCAACTCGAGTTGGCATAGCATCCTTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007791.5-394s21c3
Sequence:CCGGTGCATCCAAGTTTGCCCAGAACTCGAGTTCTGGGCAAACTTGGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007791.5-253s21c1
Sequence:CCGGCAAGTCATGTTACGGCAAGAACTCGAGTTCTTGCCGTAACATGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007791.5-993s21c2
Sequence:CCGGCCCACATCTTTGGAGACCAATCTCGAGATTGGTCTCCAAAGATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007791.2-993s1c1
Sequence:CCGGCCCACATCTTTGGAGACCAATCTCGAGATTGGTCTCCAAAGATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007791.2-155s1c1
Sequence:CCGGGAGGGCAACAGCTTCCATAAACTCGAGTTTATGGAAGCTGTTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007791.2-253s1c1
Sequence:CCGGCAAGTCATGTTACGGCAAGAACTCGAGTTCTTGCCGTAACATGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007791.2-577s1c1
Sequence:CCGGCTGTAAAGGATGCTATGCCAACTCGAGTTGGCATAGCATCCTTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007791.2-394s1c1
Sequence:CCGGTGCATCCAAGTTTGCCCAGAACTCGAGTTCTGGGCAAACTTGGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007791
VALIDATED
CSRP1 MISSION shRNA Lentiviral Transduction Particles
cysteine and glycine-rich protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007791.5-155s21c2
Sequence:CCGGGAGGGCAACAGCTTCCATAAACTCGAGTTTATGGAAGCTGTTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007791.5-577s21c2
Sequence:CCGGCTGTAAAGGATGCTATGCCAACTCGAGTTGGCATAGCATCCTTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007791.5-394s21c3
Sequence:CCGGTGCATCCAAGTTTGCCCAGAACTCGAGTTCTGGGCAAACTTGGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007791.5-253s21c1
Sequence:CCGGCAAGTCATGTTACGGCAAGAACTCGAGTTCTTGCCGTAACATGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007791.5-993s21c2
Sequence:CCGGCCCACATCTTTGGAGACCAATCTCGAGATTGGTCTCCAAAGATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007791.2-993s1c1
Sequence:CCGGCCCACATCTTTGGAGACCAATCTCGAGATTGGTCTCCAAAGATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007791.2-155s1c1
Sequence:CCGGGAGGGCAACAGCTTCCATAAACTCGAGTTTATGGAAGCTGTTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007791.2-253s1c1
Sequence:CCGGCAAGTCATGTTACGGCAAGAACTCGAGTTCTTGCCGTAACATGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007791.2-577s1c1
Sequence:CCGGCTGTAAAGGATGCTATGCCAACTCGAGTTGGCATAGCATCCTTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007791.2-394s1c1
Sequence:CCGGTGCATCCAAGTTTGCCCAGAACTCGAGTTCTGGGCAAACTTGGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004078
VALIDATED
CSRP1 MISSION shRNA Bacterial Glycerol Stock
cysteine and glycine-rich protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004078.2-340s21c1
Sequence:CCGGCCGTGCATGGTGAGGAGATTTCTCGAGAAATCTCCTCACCATGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004078.2-679s21c1
Sequence:CCGGGCGAGATTTACTGCAAAGGATCTCGAGATCCTTTGCAGTAAATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004078.2-876s21c1
Sequence:CCGGGCCACATATCACTAATGACTTCTCGAGAAGTCATTAGTGATATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004078.2-227s21c1
Sequence:CCGGGTGTCAGAAGACGGTTTACTTCTCGAGAAGTAAACCGTCTTCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004078.1-739s1c1
Sequence:CCGGGCCACATATCACTAATGACTTCTCGAGAAGTCATTAGTGATATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004078.1-542s1c1
Sequence:CCGGGCGAGATTTACTGCAAAGGATCTCGAGATCCTTTGCAGTAAATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004078.1-552s1c1
Sequence:CCGGCTGCAAAGGATGTTATGCTAACTCGAGTTAGCATAACATCCTTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004078.1-203s1c1
Sequence:CCGGCCGTGCATGGTGAGGAGATTTCTCGAGAAATCTCCTCACCATGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004078.1-90s1c1
Sequence:CCGGGTGTCAGAAGACGGTTTACTTCTCGAGAAGTAAACCGTCTTCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004078
VALIDATED
CSRP1 MISSION shRNA shRNA Plasmid DNA
cysteine and glycine-rich protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004078.2-340s21c1
Sequence:CCGGCCGTGCATGGTGAGGAGATTTCTCGAGAAATCTCCTCACCATGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004078.2-679s21c1
Sequence:CCGGGCGAGATTTACTGCAAAGGATCTCGAGATCCTTTGCAGTAAATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004078.2-876s21c1
Sequence:CCGGGCCACATATCACTAATGACTTCTCGAGAAGTCATTAGTGATATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004078.2-227s21c1
Sequence:CCGGGTGTCAGAAGACGGTTTACTTCTCGAGAAGTAAACCGTCTTCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004078.1-739s1c1
Sequence:CCGGGCCACATATCACTAATGACTTCTCGAGAAGTCATTAGTGATATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004078.1-542s1c1
Sequence:CCGGGCGAGATTTACTGCAAAGGATCTCGAGATCCTTTGCAGTAAATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004078.1-552s1c1
Sequence:CCGGCTGCAAAGGATGTTATGCTAACTCGAGTTAGCATAACATCCTTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004078.1-203s1c1
Sequence:CCGGCCGTGCATGGTGAGGAGATTTCTCGAGAAATCTCCTCACCATGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004078.1-90s1c1
Sequence:CCGGGTGTCAGAAGACGGTTTACTTCTCGAGAAGTAAACCGTCTTCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004078
VALIDATED
CSRP1 MISSION shRNA Lentiviral Transduction Particles
cysteine and glycine-rich protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004078.2-340s21c1
Sequence:CCGGCCGTGCATGGTGAGGAGATTTCTCGAGAAATCTCCTCACCATGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004078.2-679s21c1
Sequence:CCGGGCGAGATTTACTGCAAAGGATCTCGAGATCCTTTGCAGTAAATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004078.2-876s21c1
Sequence:CCGGGCCACATATCACTAATGACTTCTCGAGAAGTCATTAGTGATATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004078.2-227s21c1
Sequence:CCGGGTGTCAGAAGACGGTTTACTTCTCGAGAAGTAAACCGTCTTCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004078.1-739s1c1
Sequence:CCGGGCCACATATCACTAATGACTTCTCGAGAAGTCATTAGTGATATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004078.1-542s1c1
Sequence:CCGGGCGAGATTTACTGCAAAGGATCTCGAGATCCTTTGCAGTAAATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004078.1-552s1c1
Sequence:CCGGCTGCAAAGGATGTTATGCTAACTCGAGTTAGCATAACATCCTTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004078.1-203s1c1
Sequence:CCGGCCGTGCATGGTGAGGAGATTTCTCGAGAAATCTCCTCACCATGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004078.1-90s1c1
Sequence:CCGGGTGTCAGAAGACGGTTTACTTCTCGAGAAGTAAACCGTCTTCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks