EMAIL THIS PAGE TO A FRIEND

CSRP2

cysteine and glycine-rich protein 2

55 Gene Product Result for
Synonyms: CRP2 LMO5 SmLIM
UniProtKB ID: Q16527, Q93030
Gene ID:
Human(1466) Summary: CSRP2 is a member of the CSRP family of genes, encoding a group of LIM domain proteins, which may be involved in regulatory processes important for development and cellular differentiation. CRP2 contains two copies of the cysteine-rich amino acid sequence motif (LIM) with putative zinc-binding activity, and may be involved in regulating ordered cell growth. Other genes in the family include CSRP1 and CSRP3. [provided by RefSeq, Jul 2008]
Mouse(13008) cysteine and glycine-rich protein 2
Rat(29317) cysteine and glycine-rich protein 2
Zebrafish(393871) cysteine and glycine-rich protein 2
cow(539381) cysteine and glycine-rich protein 2
domestic cat(101084804) cysteine and glycine-rich protein 2
chicken(396128) cysteine and glycine-rich protein 2
domestic guinea pig(100735025) cysteine and glycine-rich protein 2
naked mole-rat(101704079) cysteine and glycine-rich protein 2
sheep(101123618) cysteine and glycine-rich protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007792 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007792 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007792 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001321 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001321 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001321 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001321 Rosetta Predictions human pricing
NM_177425 Rosetta Predictions rat pricing
NM_007792 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001321 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041147 predicted 481
2 SASI_Hs02_00331621 predicted 370
3 SASI_Hs01_00041149 predicted 354
4 SASI_Hs01_00041150 predicted 247
5 SASI_Hs01_00041151 predicted 378
6 SASI_Hs02_00331622 predicted 227
7 SASI_Hs01_00041153 predicted 243
8 SASI_Hs02_00331623 predicted 422
9 SASI_Hs01_00041155 predicted 372
10 SASI_Hs01_00041156 predicted 673
11 SASI_Hs01_00041148 predicted 655
12 SASI_Hs01_00041152 predicted 587
13 SASI_Hs01_00041154 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177425 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031881 predicted 297
2 SASI_Rn01_00031882 predicted 389
3 SASI_Rn01_00031883 predicted 608
4 SASI_Rn01_00031885 predicted 373
5 SASI_Rn01_00031887 predicted 546
6 SASI_Rn01_00031888 predicted 315
7 SASI_Rn01_00031889 predicted 444
8 SASI_Rn01_00031890 predicted 360
9 SASI_Rn02_00269582 predicted 346
10 SASI_Rn02_00269583 predicted 208
11 SASI_Rn01_00031884 predicted 334
12 SASI_Rn01_00031886 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007792 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027223 predicted 331
2 SASI_Mm01_00027224 predicted 611
3 SASI_Mm01_00027225 predicted 348
4 SASI_Mm01_00027226 predicted 315
5 SASI_Mm02_00312481 predicted 658
6 SASI_Mm01_00027227 predicted 396
7 SASI_Mm01_00027228 predicted 547
8 SASI_Mm01_00027229 predicted 578
9 SASI_Mm02_00312482 predicted 640
10 SASI_Mm01_00027231 predicted 260
11 SASI_Mm01_00027230 predicted 261
12 SASI_Mm01_00027232 predicted 449
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007792
VALIDATED
CSRP2 MISSION shRNA Bacterial Glycerol Stock
cysteine and glycine-rich protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007792.2-678s1c1
Sequence:CCGGGCACGACAGAGAATCTCCATTCTCGAGAATGGAGATTCTCTGTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007792.2-395s1c1
Sequence:CCGGCTTCTAAATTTGCCCAGAAATCTCGAGATTTCTGGGCAAATTTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007792.2-393s1c1
Sequence:CCGGCACTTCTAAATTTGCCCAGAACTCGAGTTCTGGGCAAATTTAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007792.2-249s1c1
Sequence:CCGGCTGCAAATCCTGCTACGGAAACTCGAGTTTCCGTAGCAGGATTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007792.2-562s1c1
Sequence:CCGGGAAGGCGAAATCTACTGTAAACTCGAGTTTACAGTAGATTTCGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007792.4-564s21c1
Sequence:CCGGGAAGGCGAAATCTACTGTAAACTCGAGTTTACAGTAGATTTCGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007792.4-460s21c1
Sequence:CCGGATGCTGCGGAGAAGATCATTGCTCGAGCAATGATCTTCTCCGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007792.4-369s21c1
Sequence:CCGGCCTCACAGGCCTACGACAAATCTCGAGATTTGTCGTAGGCCTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007792.4-643s21c1
Sequence:CCGGCCCTTGTTCATGCTCAGTAATCTCGAGATTACTGAGCATGAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007792.4-680s21c1
Sequence:CCGGGCACGACAGAGAATCTCCATTCTCGAGAATGGAGATTCTCTGTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007792
VALIDATED
CSRP2 MISSION shRNA shRNA Plasmid DNA
cysteine and glycine-rich protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007792.2-678s1c1
Sequence:CCGGGCACGACAGAGAATCTCCATTCTCGAGAATGGAGATTCTCTGTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007792.2-395s1c1
Sequence:CCGGCTTCTAAATTTGCCCAGAAATCTCGAGATTTCTGGGCAAATTTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007792.2-393s1c1
Sequence:CCGGCACTTCTAAATTTGCCCAGAACTCGAGTTCTGGGCAAATTTAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007792.2-249s1c1
Sequence:CCGGCTGCAAATCCTGCTACGGAAACTCGAGTTTCCGTAGCAGGATTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007792.2-562s1c1
Sequence:CCGGGAAGGCGAAATCTACTGTAAACTCGAGTTTACAGTAGATTTCGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007792.4-564s21c1
Sequence:CCGGGAAGGCGAAATCTACTGTAAACTCGAGTTTACAGTAGATTTCGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007792.4-460s21c1
Sequence:CCGGATGCTGCGGAGAAGATCATTGCTCGAGCAATGATCTTCTCCGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007792.4-369s21c1
Sequence:CCGGCCTCACAGGCCTACGACAAATCTCGAGATTTGTCGTAGGCCTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007792.4-643s21c1
Sequence:CCGGCCCTTGTTCATGCTCAGTAATCTCGAGATTACTGAGCATGAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007792.4-680s21c1
Sequence:CCGGGCACGACAGAGAATCTCCATTCTCGAGAATGGAGATTCTCTGTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007792
VALIDATED
CSRP2 MISSION shRNA Lentiviral Transduction Particles
cysteine and glycine-rich protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007792.2-678s1c1
Sequence:CCGGGCACGACAGAGAATCTCCATTCTCGAGAATGGAGATTCTCTGTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007792.2-395s1c1
Sequence:CCGGCTTCTAAATTTGCCCAGAAATCTCGAGATTTCTGGGCAAATTTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007792.2-393s1c1
Sequence:CCGGCACTTCTAAATTTGCCCAGAACTCGAGTTCTGGGCAAATTTAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007792.2-249s1c1
Sequence:CCGGCTGCAAATCCTGCTACGGAAACTCGAGTTTCCGTAGCAGGATTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007792.2-562s1c1
Sequence:CCGGGAAGGCGAAATCTACTGTAAACTCGAGTTTACAGTAGATTTCGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007792.4-564s21c1
Sequence:CCGGGAAGGCGAAATCTACTGTAAACTCGAGTTTACAGTAGATTTCGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007792.4-460s21c1
Sequence:CCGGATGCTGCGGAGAAGATCATTGCTCGAGCAATGATCTTCTCCGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007792.4-369s21c1
Sequence:CCGGCCTCACAGGCCTACGACAAATCTCGAGATTTGTCGTAGGCCTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007792.4-643s21c1
Sequence:CCGGCCCTTGTTCATGCTCAGTAATCTCGAGATTACTGAGCATGAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007792.4-680s21c1
Sequence:CCGGGCACGACAGAGAATCTCCATTCTCGAGAATGGAGATTCTCTGTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001321
VALIDATED
CSRP2 MISSION shRNA Bacterial Glycerol Stock
cysteine and glycine-rich protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001321.1-747s1c1
Sequence:CCGGGTGAAATTCTACCAGCATTAACTCGAGTTAATGCTGGTAGAATTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001321.1-587s1c1
Sequence:CCGGAGGATGCTATGCAAAGAACTTCTCGAGAAGTTCTTTGCATAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001321.1-515s1c1
Sequence:CCGGCCGATGTGCAAAGTGTGGGAACTCGAGTTCCCACACTTTGCACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001321.1-225s1c1
Sequence:CCGGACAGTGGCAATTCACGATGAACTCGAGTTCATCGTGAATTGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001321.1-377s1c1
Sequence:CCGGCAGGCCTACAACAAATCCAAACTCGAGTTTGGATTTGTTGTAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001321.1-225s21c1
Sequence:CCGGACAGTGGCAATTCACGATGAACTCGAGTTCATCGTGAATTGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001321.1-515s21c1
Sequence:CCGGCCGATGTGCAAAGTGTGGGAACTCGAGTTCCCACACTTTGCACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001321.1-377s21c1
Sequence:CCGGCAGGCCTACAACAAATCCAAACTCGAGTTTGGATTTGTTGTAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001321.1-747s21c1
Sequence:CCGGGTGAAATTCTACCAGCATTAACTCGAGTTAATGCTGGTAGAATTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001321
VALIDATED
CSRP2 MISSION shRNA shRNA Plasmid DNA
cysteine and glycine-rich protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001321.1-747s1c1
Sequence:CCGGGTGAAATTCTACCAGCATTAACTCGAGTTAATGCTGGTAGAATTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001321.1-587s1c1
Sequence:CCGGAGGATGCTATGCAAAGAACTTCTCGAGAAGTTCTTTGCATAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001321.1-515s1c1
Sequence:CCGGCCGATGTGCAAAGTGTGGGAACTCGAGTTCCCACACTTTGCACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001321.1-225s1c1
Sequence:CCGGACAGTGGCAATTCACGATGAACTCGAGTTCATCGTGAATTGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001321.1-377s1c1
Sequence:CCGGCAGGCCTACAACAAATCCAAACTCGAGTTTGGATTTGTTGTAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001321.1-225s21c1
Sequence:CCGGACAGTGGCAATTCACGATGAACTCGAGTTCATCGTGAATTGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001321.1-515s21c1
Sequence:CCGGCCGATGTGCAAAGTGTGGGAACTCGAGTTCCCACACTTTGCACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001321.1-377s21c1
Sequence:CCGGCAGGCCTACAACAAATCCAAACTCGAGTTTGGATTTGTTGTAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001321.1-747s21c1
Sequence:CCGGGTGAAATTCTACCAGCATTAACTCGAGTTAATGCTGGTAGAATTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001321
VALIDATED
CSRP2 MISSION shRNA Lentiviral Transduction Particles
cysteine and glycine-rich protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001321.1-747s1c1
Sequence:CCGGGTGAAATTCTACCAGCATTAACTCGAGTTAATGCTGGTAGAATTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001321.1-587s1c1
Sequence:CCGGAGGATGCTATGCAAAGAACTTCTCGAGAAGTTCTTTGCATAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001321.1-515s1c1
Sequence:CCGGCCGATGTGCAAAGTGTGGGAACTCGAGTTCCCACACTTTGCACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001321.1-225s1c1
Sequence:CCGGACAGTGGCAATTCACGATGAACTCGAGTTCATCGTGAATTGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001321.1-377s1c1
Sequence:CCGGCAGGCCTACAACAAATCCAAACTCGAGTTTGGATTTGTTGTAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001321.1-225s21c1
Sequence:CCGGACAGTGGCAATTCACGATGAACTCGAGTTCATCGTGAATTGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001321.1-515s21c1
Sequence:CCGGCCGATGTGCAAAGTGTGGGAACTCGAGTTCCCACACTTTGCACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001321.1-377s21c1
Sequence:CCGGCAGGCCTACAACAAATCCAAACTCGAGTTTGGATTTGTTGTAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001321.1-747s21c1
Sequence:CCGGGTGAAATTCTACCAGCATTAACTCGAGTTAATGCTGGTAGAATTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks