EMAIL THIS PAGE TO A FRIEND

CSRP2BP

CSRP2 binding protein

68 Gene Product Result for
Synonyms: ATAC2 CRP2BP KAT14 PRO1194 dJ717M23.1
UniProtKB ID: Q9H8E8, A2A2I5, Q96GW6, Q96IH3, Q9HBF0, Q9UIY5
Gene ID:
Human(57325) Summary: CSRP2 is a protein containing two LIM domains, which are double zinc finger motifs found in proteins of diverse function. CSRP2 and some related proteins are thought to act as protein adapters, bridging two or more proteins to form a larger protein complex. The protein encoded by this gene binds to one of the LIM domains of CSRP2 and contains an acetyltransferase domain. Although the encoded protein has been detected in the cytoplasm, it is predominantly a nuclear protein. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2011]
Mouse(228714) cysteine and glycine-rich protein 2 binding protein
Rat(362224) CSRP2 binding protein
sheep(101120935) CSRP2 binding protein
Domestic Rabbit(100356104) CSRP2 binding protein
naked mole-rat(101714942) CSRP2 binding protein
domestic guinea pig(100725772) CSRP2 binding protein
Zebrafish(562636) cysteine and glycine-rich protein 2 binding protein
dog(477146) CSRP2 binding protein
chicken(416721) CSRP2 binding protein
domestic cat(101100044) CSRP2 binding protein
cow(541019) CSRP2 binding protein
Horse(100062296) CSRP2 binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020536 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020536 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020536 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181417 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181417 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181417 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020536 Rosetta Predictions human pricing
NM_177926 Rosetta Predictions human pricing
XM_001054440 Rosetta Predictions rat pricing
XM_342530 Rosetta Predictions rat pricing
NM_181417 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175096 predicted 1225
2 SASI_Hs01_00175098 predicted 1912
3 SASI_Hs01_00175099 predicted 2927
4 SASI_Hs01_00175100 predicted 2837
5 SASI_Hs01_00175101 predicted 2760
6 SASI_Hs01_00175102 predicted 2548
7 SASI_Hs01_00175103 predicted 2979
8 SASI_Hs01_00175104 predicted 1896
9 SASI_Hs01_00175105 predicted 2106
10 SASI_Hs02_00353582 predicted 1426
11 SASI_Hs01_00175097 predicted 3011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077072 predicted 474
2 SASI_Hs01_00077074 predicted 1161
3 SASI_Hs01_00077075 predicted 2181
4 SASI_Hs01_00077076 predicted 2095
5 SASI_Hs01_00077077 predicted 2013
6 SASI_Hs01_00077078 predicted 1799
7 SASI_Hs01_00077079 predicted 2239
8 SASI_Hs01_00077080 predicted 1154
9 SASI_Hs01_00077081 predicted 1355
10 SASI_Hs02_00369420 predicted 674
11 SASI_Hs01_00077073 predicted 2274
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054440 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275765 predicted 1830
2 SASI_Rn02_00275766 predicted 806
3 SASI_Rn02_00275767 predicted 708
4 SASI_Rn02_00275768 predicted 1278
5 SASI_Rn02_00275769 predicted 648
6 SASI_Rn02_00275770 predicted 2457
7 SASI_Rn02_00275771 predicted 2319
8 SASI_Rn02_00275772 predicted 2769
9 SASI_Rn02_00275773 predicted 2076
10 SASI_Rn02_00275774 predicted 1791
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342530 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394429 predicted 1829
2 SASI_Rn02_00394430 predicted 812
3 SASI_Rn02_00394431 predicted 710
4 SASI_Rn02_00394432 predicted 1277
5 SASI_Rn02_00394433 predicted 649
6 SASI_Rn02_00394434 predicted 2448
7 SASI_Rn02_00394435 predicted 2322
8 SASI_Rn02_00394436 predicted 2769
9 SASI_Rn02_00394437 predicted 2076
10 SASI_Rn02_00394438 predicted 1790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181417 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174300 predicted 1827
2 SASI_Mm01_00174301 predicted 2766
3 SASI_Mm01_00174302 predicted 2665
4 SASI_Mm01_00174303 predicted 2447
5 SASI_Mm01_00174304 predicted 2316
6 SASI_Mm01_00174305 predicted 2349
7 SASI_Mm01_00174306 predicted 2828
8 SASI_Mm01_00174307 predicted 1788
9 SASI_Mm01_00174308 predicted 2071
10 SASI_Mm01_00174309 predicted 825
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020536
VALIDATED
CSRP2BP MISSION shRNA Bacterial Glycerol Stock
CSRP2 binding protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020536.4-3029s21c1
Sequence:CCGGTTATGAATGATGTCGTGATTCCTCGAGGAATCACGACATCATTCATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020536.4-2234s21c1
Sequence:CCGGACCTTATATCAGGCGTGATTACTCGAGTAATCACGCCTGATATAAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020536.4-717s21c1
Sequence:CCGGAGTTACCTTAAGGGTGATAATCTCGAGATTATCACCCTTAAGGTAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_020536.2-3432s1c1
Sequence:CCGGCGGCCATTGATGTGTTGTCATCTCGAGATGACAACACATCAATGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020536.2-2528s1c1
Sequence:CCGGGCACCTCTCGATTACTGTTATCTCGAGATAACAGTAATCGAGAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_020536.2-838s1c1
Sequence:CCGGGCTGTCCTACTTCTGTGACAACTCGAGTTGTCACAGAAGTAGGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020536.2-2395s1c1
Sequence:CCGGCCCTTATACCTCTCGGATCTTCTCGAGAAGATCCGAGAGGTATAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020536.2-1049s1c1
Sequence:CCGGCAAGGTTATTTCAGGTGGAAACTCGAGTTTCCACCTGAAATAACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020536
VALIDATED
CSRP2BP MISSION shRNA shRNA Plasmid DNA
CSRP2 binding protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020536.4-3029s21c1
Sequence:CCGGTTATGAATGATGTCGTGATTCCTCGAGGAATCACGACATCATTCATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020536.4-2234s21c1
Sequence:CCGGACCTTATATCAGGCGTGATTACTCGAGTAATCACGCCTGATATAAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020536.4-717s21c1
Sequence:CCGGAGTTACCTTAAGGGTGATAATCTCGAGATTATCACCCTTAAGGTAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_020536.2-3432s1c1
Sequence:CCGGCGGCCATTGATGTGTTGTCATCTCGAGATGACAACACATCAATGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020536.2-2528s1c1
Sequence:CCGGGCACCTCTCGATTACTGTTATCTCGAGATAACAGTAATCGAGAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_020536.2-838s1c1
Sequence:CCGGGCTGTCCTACTTCTGTGACAACTCGAGTTGTCACAGAAGTAGGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020536.2-2395s1c1
Sequence:CCGGCCCTTATACCTCTCGGATCTTCTCGAGAAGATCCGAGAGGTATAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020536.2-1049s1c1
Sequence:CCGGCAAGGTTATTTCAGGTGGAAACTCGAGTTTCCACCTGAAATAACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020536
VALIDATED
CSRP2BP MISSION shRNA Lentiviral Transduction Particles
CSRP2 binding protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020536.4-3029s21c1
Sequence:CCGGTTATGAATGATGTCGTGATTCCTCGAGGAATCACGACATCATTCATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020536.4-2234s21c1
Sequence:CCGGACCTTATATCAGGCGTGATTACTCGAGTAATCACGCCTGATATAAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020536.4-717s21c1
Sequence:CCGGAGTTACCTTAAGGGTGATAATCTCGAGATTATCACCCTTAAGGTAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_020536.2-3432s1c1
Sequence:CCGGCGGCCATTGATGTGTTGTCATCTCGAGATGACAACACATCAATGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020536.2-2528s1c1
Sequence:CCGGGCACCTCTCGATTACTGTTATCTCGAGATAACAGTAATCGAGAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_020536.2-838s1c1
Sequence:CCGGGCTGTCCTACTTCTGTGACAACTCGAGTTGTCACAGAAGTAGGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020536.2-2395s1c1
Sequence:CCGGCCCTTATACCTCTCGGATCTTCTCGAGAAGATCCGAGAGGTATAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020536.2-1049s1c1
Sequence:CCGGCAAGGTTATTTCAGGTGGAAACTCGAGTTTCCACCTGAAATAACCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181417
VALIDATED
CSRP2BP MISSION shRNA Bacterial Glycerol Stock
CSRP2 binding protein
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000096469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181417.2-3117s1c1
Sequence:CCGGGCCATTCTCTTCCCATACAATCTCGAGATTGTATGGGAAGAGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181417.2-2278s1c1
Sequence:CCGGCCAAAGTATTATCAGCCCTTACTCGAGTAAGGGCTGATAATACTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181417.2-956s1c1
Sequence:CCGGCAAGTTTATTTCCGGTGGAAACTCGAGTTTCCACCGGAAATAAACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181417.2-745s1c1
Sequence:CCGGGCTGTCTTACTTCTGTGACAACTCGAGTTGTCACAGAAGTAAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181417
VALIDATED
CSRP2BP MISSION shRNA shRNA Plasmid DNA
CSRP2 binding protein
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000096469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181417.2-3117s1c1
Sequence:CCGGGCCATTCTCTTCCCATACAATCTCGAGATTGTATGGGAAGAGAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181417.2-2278s1c1
Sequence:CCGGCCAAAGTATTATCAGCCCTTACTCGAGTAAGGGCTGATAATACTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181417.2-956s1c1
Sequence:CCGGCAAGTTTATTTCCGGTGGAAACTCGAGTTTCCACCGGAAATAAACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181417.2-745s1c1
Sequence:CCGGGCTGTCTTACTTCTGTGACAACTCGAGTTGTCACAGAAGTAAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181417
VALIDATED
CSRP2BP MISSION shRNA Lentiviral Transduction Particles
CSRP2 binding protein
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000096469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181417.2-3117s1c1
Sequence:CCGGGCCATTCTCTTCCCATACAATCTCGAGATTGTATGGGAAGAGAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181417.2-2278s1c1
Sequence:CCGGCCAAAGTATTATCAGCCCTTACTCGAGTAAGGGCTGATAATACTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181417.2-956s1c1
Sequence:CCGGCAAGTTTATTTCCGGTGGAAACTCGAGTTTCCACCGGAAATAAACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181417.2-745s1c1
Sequence:CCGGGCTGTCTTACTTCTGTGACAACTCGAGTTGTCACAGAAGTAAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)