EMAIL THIS PAGE TO A FRIEND

CSRP3

cysteine and glycine-rich protein 3 (cardiac LIM protein)

65 Gene Product Result for
Synonyms: CLP CMD1M CMH12 CRP3 LMO4 MLP
UniProtKB ID: P50461, Q9P131
Gene ID:
Human(8048) Summary: This gene encodes a member of the CSRP family of LIM domain proteins, which may be involved in regulatory processes important for development and cellular differentiation. The LIM/double zinc-finger motif found in this protein is found in a group of proteins with critical functions in gene regulation, cell growth, and somatic differentiation. Mutations in this gene are thought to cause heritable forms of hypertrophic cardiomyopathy (HCM) and dilated cardiomyopathy (DCM) in humans. Alternatively spliced transcript variants with different 5' UTR, but encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(13009) cysteine and glycine-rich protein 3
Rat(117505) cysteine and glycine-rich protein 3 (cardiac LIM protein)
Zebrafish(450005) cysteine and glycine-rich protein 3 (cardiac LIM protein)
chicken(422979) cysteine and glycine-rich protein 3 (cardiac LIM protein)
cow(540407) cysteine and glycine-rich protein 3 (cardiac LIM protein)
domestic cat(101082091) cysteine and glycine-rich protein 3 (cardiac LIM protein)
dog(610946) cysteine and glycine-rich protein 3 (cardiac LIM protein)
domestic guinea pig(100724250) cysteine and glycine-rich protein 3 (cardiac LIM protein)
naked mole-rat(101722085) cysteine and glycine-rich protein 3 (cardiac LIM protein)
sheep(101115999) cysteine and glycine-rich protein 3 (cardiac LIM protein)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003476 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003476 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003476 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013808 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013808 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013808 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127656 Rosetta Predictions human pricing
NM_003476 Rosetta Predictions human pricing
NM_057144 Rosetta Predictions rat pricing
NM_013808 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330004 predicted 605
2 SASI_Hs02_00330005 predicted 555
3 SASI_Hs02_00330006 predicted 545
4 SASI_Hs02_00330007 predicted 476
5 SASI_Hs02_00330008 predicted 724
6 SASI_Hs02_00330009 predicted 777
7 SASI_Hs02_00330010 predicted 898
8 SASI_Hs02_00330011 predicted 897
9 SASI_Hs02_00330012 predicted 833
10 SASI_Hs02_00330013 predicted 691
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335736 predicted 660
2 SASI_Hs01_00171709 predicted 612
3 SASI_Hs01_00171710 predicted 603
4 SASI_Hs01_00171712 predicted 529
5 SASI_Hs01_00171713 predicted 772
6 SASI_Hs01_00171714 predicted 835
7 SASI_Hs01_00171715 predicted 951
8 SASI_Hs02_00335737 predicted 947
9 SASI_Hs02_00335738 predicted 890
10 SASI_Hs01_00171716 predicted 740
11 SASI_Hs01_00171711 predicted 444
12 SASI_Hs01_00171717 predicted 711
13 SASI_Hs01_00171718 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057144 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082297 predicted 353
2 SASI_Rn01_00082298 predicted 195
3 SASI_Rn02_00267101 predicted 490
4 SASI_Rn01_00082299 predicted 445
5 SASI_Rn02_00267102 predicted 348
6 SASI_Rn01_00082300 predicted 413
7 SASI_Rn01_00082302 predicted 341
8 SASI_Rn01_00082304 predicted 399
9 SASI_Rn01_00082305 predicted 216
10 SASI_Rn02_00267103 predicted 494
11 SASI_Rn01_00082301 predicted 364
12 SASI_Rn01_00082303 predicted 349
13 SASI_Rn01_00082306 predicted 397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013808 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024492 predicted 632
2 SASI_Mm01_00024493 predicted 397
3 SASI_Mm01_00024494 predicted 584
4 SASI_Mm01_00024495 predicted 244
5 SASI_Mm01_00024496 predicted 320
6 SASI_Mm01_00024497 predicted 392
7 SASI_Mm01_00024498 predicted 226
8 SASI_Mm01_00024499 predicted 229
9 SASI_Mm01_00024500 predicted 617
10 SASI_Mm01_00024501 predicted 633
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003476
CSRP3 MISSION shRNA Bacterial Glycerol Stock
cysteine and glycine-rich protein 3 (cardiac LIM protein)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118032    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003476.2-1104s1c1
Sequence:CCGGGCGCAAAGGAAAGCAGTCTTTCTCGAGAAAGACTGCTTTCCTTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003476.2-683s1c1
Sequence:CCGGGCCTTACACAACAAGTGGAAACTCGAGTTTCCACTTGTTGTGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003476.2-176s1c1
Sequence:CCGGCCGTCTACCATGCAGAAGAAACTCGAGTTTCTTCTGCATGGTAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003476.2-595s1c1
Sequence:CCGGTCCACAAATGTCACTGACAAACTCGAGTTTGTCAGTGACATTTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003476.2-493s1c1
Sequence:CCGGCGATGTGGCAAGTCAGTCTATCTCGAGATAGACTGACTTGCCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003476.3-202s21c1
Sequence:CCGGAGTTTCCACAAGACGTGTTTCCTCGAGGAAACACGTCTTGTGGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003476
CSRP3 MISSION shRNA shRNA Plasmid DNA
cysteine and glycine-rich protein 3 (cardiac LIM protein)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118032    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003476.2-1104s1c1
Sequence:CCGGGCGCAAAGGAAAGCAGTCTTTCTCGAGAAAGACTGCTTTCCTTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003476.2-683s1c1
Sequence:CCGGGCCTTACACAACAAGTGGAAACTCGAGTTTCCACTTGTTGTGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003476.2-176s1c1
Sequence:CCGGCCGTCTACCATGCAGAAGAAACTCGAGTTTCTTCTGCATGGTAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003476.2-595s1c1
Sequence:CCGGTCCACAAATGTCACTGACAAACTCGAGTTTGTCAGTGACATTTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003476.2-493s1c1
Sequence:CCGGCGATGTGGCAAGTCAGTCTATCTCGAGATAGACTGACTTGCCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003476.3-202s21c1
Sequence:CCGGAGTTTCCACAAGACGTGTTTCCTCGAGGAAACACGTCTTGTGGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003476
CSRP3 MISSION shRNA Lentiviral Transduction Particles
cysteine and glycine-rich protein 3 (cardiac LIM protein)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118032    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003476.2-1104s1c1
Sequence:CCGGGCGCAAAGGAAAGCAGTCTTTCTCGAGAAAGACTGCTTTCCTTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003476.2-683s1c1
Sequence:CCGGGCCTTACACAACAAGTGGAAACTCGAGTTTCCACTTGTTGTGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003476.2-176s1c1
Sequence:CCGGCCGTCTACCATGCAGAAGAAACTCGAGTTTCTTCTGCATGGTAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003476.2-595s1c1
Sequence:CCGGTCCACAAATGTCACTGACAAACTCGAGTTTGTCAGTGACATTTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003476.2-493s1c1
Sequence:CCGGCGATGTGGCAAGTCAGTCTATCTCGAGATAGACTGACTTGCCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003476.3-202s21c1
Sequence:CCGGAGTTTCCACAAGACGTGTTTCCTCGAGGAAACACGTCTTGTGGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013808
CSRP3 MISSION shRNA Bacterial Glycerol Stock
cysteine and glycine-rich protein 3 (cardiac LIM protein)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193803    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013808.3-828s1c1
Sequence:CCGGCTGCAACAGATGCTTCACTATCTCGAGATAGTGAAGCATCTGTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013808.3-140s1c1
Sequence:CCGGGCAGAAGAAATCCAGTGCAATCTCGAGATTGCACTGGATTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013808.3-166s1c1
Sequence:CCGGGAGTTTCCACAAGACCTGTTTCTCGAGAAACAGGTCTTGTGGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013808.3-417s1c1
Sequence:CCGGCAAAGTTTGGAGAATCAGAGACTCGAGTCTCTGATTCTCCAAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013808.3-444s1c1
Sequence:CCGGCACGATGTGGAAAGTCGGTATCTCGAGATACCGACTTTCCACATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013808.3-574s21c1
Sequence:CCGGGGAGCTCTACTGCAAAGTTTGCTCGAGCAAACTTTGCAGTAGAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013808.3-346s21c1
Sequence:CCGGTGGCCTGCAGTTCCAACAATCCTCGAGGATTGTTGGAACTGCAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013808.3-859s21c1
Sequence:CCGGTGGGATGGGAGAGACAATAAACTCGAGTTTATTGTCTCTCCCATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013808.3-239s1c1
Sequence:CCGGGAGTCAGAGATCTACTGTAAGCTCGAGCTTACAGTAGATCTCTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013808
CSRP3 MISSION shRNA shRNA Plasmid DNA
cysteine and glycine-rich protein 3 (cardiac LIM protein)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193803    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013808.3-828s1c1
Sequence:CCGGCTGCAACAGATGCTTCACTATCTCGAGATAGTGAAGCATCTGTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013808.3-140s1c1
Sequence:CCGGGCAGAAGAAATCCAGTGCAATCTCGAGATTGCACTGGATTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013808.3-166s1c1
Sequence:CCGGGAGTTTCCACAAGACCTGTTTCTCGAGAAACAGGTCTTGTGGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013808.3-417s1c1
Sequence:CCGGCAAAGTTTGGAGAATCAGAGACTCGAGTCTCTGATTCTCCAAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013808.3-444s1c1
Sequence:CCGGCACGATGTGGAAAGTCGGTATCTCGAGATACCGACTTTCCACATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013808.3-574s21c1
Sequence:CCGGGGAGCTCTACTGCAAAGTTTGCTCGAGCAAACTTTGCAGTAGAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013808.3-346s21c1
Sequence:CCGGTGGCCTGCAGTTCCAACAATCCTCGAGGATTGTTGGAACTGCAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013808.3-859s21c1
Sequence:CCGGTGGGATGGGAGAGACAATAAACTCGAGTTTATTGTCTCTCCCATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013808.3-239s1c1
Sequence:CCGGGAGTCAGAGATCTACTGTAAGCTCGAGCTTACAGTAGATCTCTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013808
CSRP3 MISSION shRNA Lentiviral Transduction Particles
cysteine and glycine-rich protein 3 (cardiac LIM protein)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193803    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013808.3-828s1c1
Sequence:CCGGCTGCAACAGATGCTTCACTATCTCGAGATAGTGAAGCATCTGTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013808.3-140s1c1
Sequence:CCGGGCAGAAGAAATCCAGTGCAATCTCGAGATTGCACTGGATTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013808.3-166s1c1
Sequence:CCGGGAGTTTCCACAAGACCTGTTTCTCGAGAAACAGGTCTTGTGGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013808.3-417s1c1
Sequence:CCGGCAAAGTTTGGAGAATCAGAGACTCGAGTCTCTGATTCTCCAAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013808.3-444s1c1
Sequence:CCGGCACGATGTGGAAAGTCGGTATCTCGAGATACCGACTTTCCACATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013808.3-574s21c1
Sequence:CCGGGGAGCTCTACTGCAAAGTTTGCTCGAGCAAACTTTGCAGTAGAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013808.3-346s21c1
Sequence:CCGGTGGCCTGCAGTTCCAACAATCCTCGAGGATTGTTGGAACTGCAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013808.3-859s21c1
Sequence:CCGGTGGGATGGGAGAGACAATAAACTCGAGTTTATTGTCTCTCCCATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013808.3-239s1c1
Sequence:CCGGGAGTCAGAGATCTACTGTAAGCTCGAGCTTACAGTAGATCTCTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks