EMAIL THIS PAGE TO A FRIEND

CST11

cystatin 11

59 Gene Product Result for
Synonyms: CST8L CTES2 SC13 dJ322G13.6
UniProtKB ID: Q9H112, Q0VAF2, Q0VAF3, Q8WXU5, Q8WXU6, Q9H113
Gene ID:
Human(140880) Summary: The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes an epididymal-specific protein whose specific function has not been determined. Alternative splicing yields two variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(78240) cystatin 11
Rat(245916) cystatin 11
sheep(101104262) cystatin 11
Horse(100058925) cystatin 11
dog(606832) cystatin 11
cow(523144) cystatin 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080830 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080830 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080830 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_283777 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_283777 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_283777 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080830 Rosetta Predictions human pricing
NM_130794 Rosetta Predictions human pricing
NM_139085 Rosetta Predictions rat pricing
NM_030059 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188481 predicted 217
2 SASI_Hs01_00188482 predicted 210
3 SASI_Hs01_00188483 predicted 226
4 SASI_Hs01_00188485 predicted 224
5 SASI_Hs01_00188486 predicted 201
6 SASI_Hs01_00188487 predicted 209
7 SASI_Hs01_00188488 predicted 289
8 SASI_Hs01_00188489 predicted 177
9 SASI_Hs01_00188490 predicted 225
10 SASI_Hs02_00362619 predicted 390
11 SASI_Hs01_00188484 predicted 206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130794 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030619 predicted 264
2 SASI_Hs01_00030620 predicted 228
3 SASI_Hs01_00030621 predicted 229
4 SASI_Hs01_00030622 predicted 223
5 SASI_Hs01_00030623 predicted 211
6 SASI_Hs01_00030624 predicted 263
7 SASI_Hs02_00362825 predicted 284
8 SASI_Hs01_00030625 predicted 257
9 SASI_Hs02_00362826 predicted 225
10 SASI_Hs01_00030627 predicted 209
11 SASI_Hs01_00030626 predicted 229
12 SASI_Hs01_00030628 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139085 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071184 predicted 198
2 SASI_Rn01_00071185 predicted 201
3 SASI_Rn01_00071186 predicted 209
4 SASI_Rn01_00071187 predicted 200
5 SASI_Rn01_00071188 predicted 205
6 SASI_Rn01_00071189 predicted 206
7 SASI_Rn01_00071190 predicted 197
8 SASI_Rn01_00071192 predicted 210
9 SASI_Rn01_00071193 predicted 15
10 SASI_Rn02_00268447 predicted 144
11 SASI_Rn01_00071191 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030059 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147070 predicted 324
2 SASI_Mm01_00147071 predicted 200
3 SASI_Mm01_00147072 predicted 376
4 SASI_Mm01_00147073 predicted 289
5 SASI_Mm01_00147074 predicted 226
6 SASI_Mm01_00147075 predicted 223
7 SASI_Mm01_00147076 predicted 202
8 SASI_Mm01_00147077 predicted 236
9 SASI_Mm01_00147078 predicted 320
10 SASI_Mm01_00147079 predicted 272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080830
CST11 MISSION shRNA Bacterial Glycerol Stock
cystatin 11
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080830.2-189s1c1
Sequence:CCGGCCGACCAGTATAACAAGGAAACTCGAGTTTCCTTGTTATACTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080830.2-64s1c1
Sequence:CCGGGCTCCTGTTGGCCATTCTATTCTCGAGAATAGAATGGCCAACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080830.2-122s1c1
Sequence:CCGGACCTTTCTAAGCGTCCATGAACTCGAGTTCATGGACGCTTAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080830.2-259s1c1
Sequence:CCGGGCAGCAAGTCAACTGCTTCTTCTCGAGAAGAAGCAGTTGACTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080830.2-284s1c1
Sequence:CCGGGTGTTTGCTGTACCCTGGTTTCTCGAGAAACCAGGGTACAGCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080830.2-133s21c1
Sequence:CCGGCGTCCATGAAGTGATGGCAGTCTCGAGACTGCCATCACTTCATGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080830.2-159s21c1
Sequence:CCGGACTATGCGAAGGACAGCTTGCCTCGAGGCAAGCTGTCCTTCGCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080830.2-231s21c1
Sequence:CCGGGGATCTTCCGAGTCCTTAAAGCTCGAGCTTTAAGGACTCGGAAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080830.2-80s21c1
Sequence:CCGGCTATTGACTCTGATGGCCCTCCTCGAGGAGGGCCATCAGAGTCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080830
CST11 MISSION shRNA shRNA Plasmid DNA
cystatin 11
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080830.2-189s1c1
Sequence:CCGGCCGACCAGTATAACAAGGAAACTCGAGTTTCCTTGTTATACTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080830.2-64s1c1
Sequence:CCGGGCTCCTGTTGGCCATTCTATTCTCGAGAATAGAATGGCCAACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080830.2-122s1c1
Sequence:CCGGACCTTTCTAAGCGTCCATGAACTCGAGTTCATGGACGCTTAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080830.2-259s1c1
Sequence:CCGGGCAGCAAGTCAACTGCTTCTTCTCGAGAAGAAGCAGTTGACTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080830.2-284s1c1
Sequence:CCGGGTGTTTGCTGTACCCTGGTTTCTCGAGAAACCAGGGTACAGCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080830.2-133s21c1
Sequence:CCGGCGTCCATGAAGTGATGGCAGTCTCGAGACTGCCATCACTTCATGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080830.2-159s21c1
Sequence:CCGGACTATGCGAAGGACAGCTTGCCTCGAGGCAAGCTGTCCTTCGCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080830.2-231s21c1
Sequence:CCGGGGATCTTCCGAGTCCTTAAAGCTCGAGCTTTAAGGACTCGGAAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080830.2-80s21c1
Sequence:CCGGCTATTGACTCTGATGGCCCTCCTCGAGGAGGGCCATCAGAGTCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080830
CST11 MISSION shRNA Lentiviral Transduction Particles
cystatin 11
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080830.2-189s1c1
Sequence:CCGGCCGACCAGTATAACAAGGAAACTCGAGTTTCCTTGTTATACTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080830.2-64s1c1
Sequence:CCGGGCTCCTGTTGGCCATTCTATTCTCGAGAATAGAATGGCCAACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080830.2-122s1c1
Sequence:CCGGACCTTTCTAAGCGTCCATGAACTCGAGTTCATGGACGCTTAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080830.2-259s1c1
Sequence:CCGGGCAGCAAGTCAACTGCTTCTTCTCGAGAAGAAGCAGTTGACTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080830.2-284s1c1
Sequence:CCGGGTGTTTGCTGTACCCTGGTTTCTCGAGAAACCAGGGTACAGCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080830.2-133s21c1
Sequence:CCGGCGTCCATGAAGTGATGGCAGTCTCGAGACTGCCATCACTTCATGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080830.2-159s21c1
Sequence:CCGGACTATGCGAAGGACAGCTTGCCTCGAGGCAAGCTGTCCTTCGCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080830.2-231s21c1
Sequence:CCGGGGATCTTCCGAGTCCTTAAAGCTCGAGCTTTAAGGACTCGGAAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080830.2-80s21c1
Sequence:CCGGCTATTGACTCTGATGGCCCTCCTCGAGGAGGGCCATCAGAGTCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_283777
CST11 MISSION shRNA Bacterial Glycerol Stock
cystatin 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283777.3-433s1c1
Sequence:CCGGCCAGTGCTACTTCTCAGTGTACTCGAGTACACTGAGAAGTAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283777.3-161s1c1
Sequence:CCGGAGCTACCAAGTAAAGAGGAAACTCGAGTTTCCTCTTTACTTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283777.3-217s1c1
Sequence:CCGGGTCTTCTGTGAAGGAGACATTCTCGAGAATGTCTCCTTCACAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283777.3-247s1c1
Sequence:CCGGCACAGATGAATACAACAAGAACTCGAGTTCTTGTTGTATTCATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283777.3-340s1c1
Sequence:CCGGGTATCACATCACAGTGGAAATCTCGAGATTTCCACTGTGATGTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_283777
CST11 MISSION shRNA shRNA Plasmid DNA
cystatin 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283777.3-433s1c1
Sequence:CCGGCCAGTGCTACTTCTCAGTGTACTCGAGTACACTGAGAAGTAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283777.3-161s1c1
Sequence:CCGGAGCTACCAAGTAAAGAGGAAACTCGAGTTTCCTCTTTACTTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283777.3-217s1c1
Sequence:CCGGGTCTTCTGTGAAGGAGACATTCTCGAGAATGTCTCCTTCACAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283777.3-247s1c1
Sequence:CCGGCACAGATGAATACAACAAGAACTCGAGTTCTTGTTGTATTCATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283777.3-340s1c1
Sequence:CCGGGTATCACATCACAGTGGAAATCTCGAGATTTCCACTGTGATGTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_283777
CST11 MISSION shRNA Lentiviral Transduction Particles
cystatin 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283777.3-433s1c1
Sequence:CCGGCCAGTGCTACTTCTCAGTGTACTCGAGTACACTGAGAAGTAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283777.3-161s1c1
Sequence:CCGGAGCTACCAAGTAAAGAGGAAACTCGAGTTTCCTCTTTACTTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283777.3-217s1c1
Sequence:CCGGGTCTTCTGTGAAGGAGACATTCTCGAGAATGTCTCCTTCACAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283777.3-247s1c1
Sequence:CCGGCACAGATGAATACAACAAGAACTCGAGTTCTTGTTGTATTCATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283777.3-340s1c1
Sequence:CCGGGTATCACATCACAGTGGAAATCTCGAGATTTCCACTGTGATGTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks