EMAIL THIS PAGE TO A FRIEND

CST1

cystatin SN

23 Gene Product Result for
Species: Human CST1(1469)
UniProtKB ID: P01037, Q96LE6, Q9UCQ6
Gene ID:
Human(1469) Summary: The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions, where they appear to provide protective functions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a cysteine proteinase inhibitor found in saliva, tears, urine, and seminal fluid. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001898 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001898 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001898 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111511 MISSION® esiRNA esiRNA human CST1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001898 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111128 predicted 238
2 SASI_Hs01_00111133 predicted 243
3 SASI_Hs01_00111134 predicted 268
4 SASI_Hs02_00332766 predicted 450
5 SASI_Hs02_00332767 predicted 245
6 SASI_Hs02_00332768 predicted 66
7 SASI_Hs02_00332769 predicted 160
8 SASI_Hs02_00332770 predicted 163
9 SASI_Hs01_00111129 predicted 469
10 SASI_Hs01_00111130 predicted 428
11 SASI_Hs01_00111131 predicted 440
12 SASI_Hs01_00111132 predicted 428
13 SASI_Hs01_00111135 predicted 422
14 SASI_Hs01_00111136 predicted 208
15 SASI_Hs01_00111137 predicted 476
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001898
VALIDATED
CST1 MISSION shRNA Bacterial Glycerol Stock
cystatin SN
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001898.2-185s21c1
Sequence:CCGGCCTCAATGATGAGTGGGTACACTCGAGTGTACCCACTCATCATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001898.2-313s21c1
Sequence:CCGGTGAATTACTTCTTCGACGTAGCTCGAGCTACGTCGAAGAAGTAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001898.2-140s21c1
Sequence:CCGGCAAGGAGGAGGATAGGATAATCTCGAGATTATCCTATCCTCCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001898.2-457s21c1
Sequence:CCGGACAGAAGGTCCCTGGTGAAATCTCGAGATTTCACCAGGGACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001898.2-507s1c1
Sequence:CCGGCCAGGCCATTCGCACCAGCCACTCGAGTGGCTGGTGCGAATGGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001898.2-276s1c1
Sequence:CCGGCGGGTACTAAGAGCCAGGCAACTCGAGTTGCCTGGCTCTTAGTACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001898.2-410s1c1
Sequence:CCGGGAAGAAACAGTTGTGCTCTTTCTCGAGAAAGAGCACAACTGTTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_001898.2-230s1c1
Sequence:CCGGCGAGTATAACAAGGCCACCAACTCGAGTTGGTGGCCTTGTTATACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001898.2-162s1c1
Sequence:CCGGCCGGGTGGCATCTATAACGCACTCGAGTGCGTTATAGATGCCACCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001898
VALIDATED
CST1 MISSION shRNA shRNA Plasmid DNA
cystatin SN
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001898.2-185s21c1
Sequence:CCGGCCTCAATGATGAGTGGGTACACTCGAGTGTACCCACTCATCATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001898.2-313s21c1
Sequence:CCGGTGAATTACTTCTTCGACGTAGCTCGAGCTACGTCGAAGAAGTAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001898.2-140s21c1
Sequence:CCGGCAAGGAGGAGGATAGGATAATCTCGAGATTATCCTATCCTCCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001898.2-457s21c1
Sequence:CCGGACAGAAGGTCCCTGGTGAAATCTCGAGATTTCACCAGGGACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001898.2-507s1c1
Sequence:CCGGCCAGGCCATTCGCACCAGCCACTCGAGTGGCTGGTGCGAATGGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001898.2-276s1c1
Sequence:CCGGCGGGTACTAAGAGCCAGGCAACTCGAGTTGCCTGGCTCTTAGTACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001898.2-410s1c1
Sequence:CCGGGAAGAAACAGTTGTGCTCTTTCTCGAGAAAGAGCACAACTGTTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_001898.2-230s1c1
Sequence:CCGGCGAGTATAACAAGGCCACCAACTCGAGTTGGTGGCCTTGTTATACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001898.2-162s1c1
Sequence:CCGGCCGGGTGGCATCTATAACGCACTCGAGTGCGTTATAGATGCCACCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001898
VALIDATED
CST1 MISSION shRNA Lentiviral Transduction Particles
cystatin SN
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001898.2-185s21c1
Sequence:CCGGCCTCAATGATGAGTGGGTACACTCGAGTGTACCCACTCATCATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001898.2-313s21c1
Sequence:CCGGTGAATTACTTCTTCGACGTAGCTCGAGCTACGTCGAAGAAGTAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001898.2-140s21c1
Sequence:CCGGCAAGGAGGAGGATAGGATAATCTCGAGATTATCCTATCCTCCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001898.2-457s21c1
Sequence:CCGGACAGAAGGTCCCTGGTGAAATCTCGAGATTTCACCAGGGACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001898.2-507s1c1
Sequence:CCGGCCAGGCCATTCGCACCAGCCACTCGAGTGGCTGGTGCGAATGGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001898.2-276s1c1
Sequence:CCGGCGGGTACTAAGAGCCAGGCAACTCGAGTTGCCTGGCTCTTAGTACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001898.2-410s1c1
Sequence:CCGGGAAGAAACAGTTGTGCTCTTTCTCGAGAAAGAGCACAACTGTTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_001898.2-230s1c1
Sequence:CCGGCGAGTATAACAAGGCCACCAACTCGAGTTGGTGGCCTTGTTATACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001898.2-162s1c1
Sequence:CCGGCCGGGTGGCATCTATAACGCACTCGAGTGCGTTATAGATGCCACCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks