EMAIL THIS PAGE TO A FRIEND

CST2

cystatin SA

24 Gene Product Result for
Species: Human CST2(1470)
UniProtKB ID: P09228, Q9UCQ7
Gene ID:
Human(1470) Summary: The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions, where they appear to provide protective functions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a secreted thiol protease inhibitor found at high levels in saliva, tears and seminal plasma. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001322 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001322 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001322 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147911 MISSION® esiRNA esiRNA human CST2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001322 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001322 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103063 predicted 270
2 SASI_Hs01_00103066 predicted 438
3 SASI_Hs02_00331624 predicted 174
4 SASI_Hs01_00103057 predicted 343
5 SASI_Hs01_00103058 predicted 406
6 SASI_Hs01_00103059 predicted 403
7 SASI_Hs01_00103060 predicted 431
8 SASI_Hs01_00103061 predicted 411
9 SASI_Hs01_00103062 predicted 333
10 SASI_Hs01_00103064 predicted 411
11 SASI_Hs01_00103065 predicted 412
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001322
VALIDATED
CST2 MISSION shRNA Bacterial Glycerol Stock
cystatin SA
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006741    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001322.2-453s1c1
Sequence:CCGGAGGGAGTCACACTGACCACCTCTCGAGAGGTGGTCAGTGTGACTCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001322.2-328s1c1
Sequence:CCGGGCCTTCCATGAACAGCCAGAACTCGAGTTCTGGCTGTTCATGGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001322.2-175s1c1
Sequence:CCGGGAGTATAACAAGGCCACTGAACTCGAGTTCAGTGGCCTTGTTATACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_001322.2-256s1c1
Sequence:CCGGGTGAATTACTTCTTCGACATACTCGAGTATGTCGAAGAAGTAATTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001322.2-118s21c1
Sequence:CCGGTATGATGCAGACCTCAATGATCTCGAGATCATTGAGGTCTGCATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001322.2-147s21c1
Sequence:CCGGACAGCGTGCCCTTCACTTTGTCTCGAGACAAAGTGAAGGGCACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001322.2-371s21c1
Sequence:CCGGCTTTCCAGATCTACGAAGTTCCTCGAGGAACTTCGTAGATCTGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001322.2-163s21c1
Sequence:CCGGTTTGTCATCAGCGAGTATAACCTCGAGGTTATACTCGCTGATGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001322.2-186s21c1
Sequence:CCGGGGCCACTGAAGATGAGTACTACTCGAGTAGTACTCATCTTCAGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001322.2-101s21c1
Sequence:CCGGTAATCGAGGGTGGCATCTATGCTCGAGCATAGATGCCACCCTCGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001322.2-257s21c1
Sequence:CCGGTGAATTACTTCTTCGACATAGCTCGAGCTATGTCGAAGAAGTAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001322
VALIDATED
CST2 MISSION shRNA shRNA Plasmid DNA
cystatin SA
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006741    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001322.2-453s1c1
Sequence:CCGGAGGGAGTCACACTGACCACCTCTCGAGAGGTGGTCAGTGTGACTCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001322.2-328s1c1
Sequence:CCGGGCCTTCCATGAACAGCCAGAACTCGAGTTCTGGCTGTTCATGGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001322.2-175s1c1
Sequence:CCGGGAGTATAACAAGGCCACTGAACTCGAGTTCAGTGGCCTTGTTATACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_001322.2-256s1c1
Sequence:CCGGGTGAATTACTTCTTCGACATACTCGAGTATGTCGAAGAAGTAATTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001322.2-118s21c1
Sequence:CCGGTATGATGCAGACCTCAATGATCTCGAGATCATTGAGGTCTGCATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001322.2-147s21c1
Sequence:CCGGACAGCGTGCCCTTCACTTTGTCTCGAGACAAAGTGAAGGGCACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001322.2-371s21c1
Sequence:CCGGCTTTCCAGATCTACGAAGTTCCTCGAGGAACTTCGTAGATCTGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001322.2-163s21c1
Sequence:CCGGTTTGTCATCAGCGAGTATAACCTCGAGGTTATACTCGCTGATGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001322.2-186s21c1
Sequence:CCGGGGCCACTGAAGATGAGTACTACTCGAGTAGTACTCATCTTCAGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001322.2-101s21c1
Sequence:CCGGTAATCGAGGGTGGCATCTATGCTCGAGCATAGATGCCACCCTCGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001322.2-257s21c1
Sequence:CCGGTGAATTACTTCTTCGACATAGCTCGAGCTATGTCGAAGAAGTAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001322
VALIDATED
CST2 MISSION shRNA Lentiviral Transduction Particles
cystatin SA
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006741    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001322.2-453s1c1
Sequence:CCGGAGGGAGTCACACTGACCACCTCTCGAGAGGTGGTCAGTGTGACTCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001322.2-328s1c1
Sequence:CCGGGCCTTCCATGAACAGCCAGAACTCGAGTTCTGGCTGTTCATGGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001322.2-175s1c1
Sequence:CCGGGAGTATAACAAGGCCACTGAACTCGAGTTCAGTGGCCTTGTTATACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_001322.2-256s1c1
Sequence:CCGGGTGAATTACTTCTTCGACATACTCGAGTATGTCGAAGAAGTAATTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001322.2-118s21c1
Sequence:CCGGTATGATGCAGACCTCAATGATCTCGAGATCATTGAGGTCTGCATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001322.2-147s21c1
Sequence:CCGGACAGCGTGCCCTTCACTTTGTCTCGAGACAAAGTGAAGGGCACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001322.2-371s21c1
Sequence:CCGGCTTTCCAGATCTACGAAGTTCCTCGAGGAACTTCGTAGATCTGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001322.2-163s21c1
Sequence:CCGGTTTGTCATCAGCGAGTATAACCTCGAGGTTATACTCGCTGATGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001322.2-186s21c1
Sequence:CCGGGGCCACTGAAGATGAGTACTACTCGAGTAGTACTCATCTTCAGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001322.2-101s21c1
Sequence:CCGGTAATCGAGGGTGGCATCTATGCTCGAGCATAGATGCCACCCTCGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001322.2-257s21c1
Sequence:CCGGTGAATTACTTCTTCGACATAGCTCGAGCTATGTCGAAGAAGTAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks