EMAIL THIS PAGE TO A FRIEND

CST4

cystatin S

Species: Human CST4(1472)
UniProtKB ID: P01036, Q9UBI5, Q9UCS9
Gene ID:
Human(1472) Summary: The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a type 2 salivary cysteine peptidase inhibitor. The protein is an S-type cystatin, based on its high level of expression in saliva, tears and seminal plasma. The specific role in these fluids is unclear but antibacterial and antiviral activity is present, consistent with a protective function. [provided by RefSeq, Jul 2008]
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001899 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001899 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001899 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111131 MISSION® esiRNA esiRNA human CST4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001899 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029640 predicted 212
2 SASI_Hs02_00332771 predicted 483
3 SASI_Hs02_00332772 predicted 62
4 SASI_Hs02_00332773 predicted 74
5 SASI_Hs01_00029641 predicted 414
6 SASI_Hs01_00029642 predicted 388
7 SASI_Hs01_00029643 predicted 443
8 SASI_Hs01_00029644 predicted 409
9 SASI_Hs01_00029645 predicted 406
10 SASI_Hs01_00029646 predicted 405
11 SASI_Hs01_00029647 predicted 439
12 SASI_Hs01_00029648 predicted 453
13 SASI_Hs01_00029649 predicted 376
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001899
VALIDATED
CST4 MISSION shRNA Bacterial Glycerol Stock
cystatin S
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001899.2-523s1c1
Sequence:CCGGCCACCCACTGTAGTGCTCCCACTCGAGTGGGAGCACTACAGTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001899.2-297s1c1
Sequence:CCGGGTGAATTACTTCTTCGACGTACTCGAGTACGTCGAAGAAGTAATTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001899.2-441s1c1
Sequence:CCGGGACAGAATGTCCCTGGTGAATCTCGAGATTCACCAGGGACATTCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001899.2-168s1c1
Sequence:CCGGGACCTCAATGATGAGTGGGTACTCGAGTACCCACTCATCATTGAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001899.2-118s1c1
Sequence:CCGGCGAGCTCCAAGGAGGAGAATACTCGAGTATTCTCCTCCTTGGAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001899.2-117s21c1
Sequence:CCGGTCGAGCTCCAAGGAGGAGAATCTCGAGATTCTCCTCCTTGGAGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001899.2-229s21c1
Sequence:CCGGCCACCGAAGATGAGTACTACACTCGAGTGTAGTACTCATCTTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001899.2-203s21c1
Sequence:CCGGCTTCGCCATCAGCGAGTACAACTCGAGTTGTACTCGCTGATGGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001899.2-144s21c1
Sequence:CCGGATCCCAGGTGGCATCTATGATCTCGAGATCATAGATGCCACCTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001899.2-412s21c1
Sequence:CCGGCTTTCGAGATCTACGAAGTTCCTCGAGGAACTTCGTAGATCTCGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001899.2-338s21c1
Sequence:CCGGTACCAAGTCCCAGCCCAACTTCTCGAGAAGTTGGGCTGGGACTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001899.2-362s21c1
Sequence:CCGGCACCTGTGCCTTCCATGAACACTCGAGTGTTCATGGAAGGCACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001899
VALIDATED
CST4 MISSION shRNA shRNA Plasmid DNA
cystatin S
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001899.2-523s1c1
Sequence:CCGGCCACCCACTGTAGTGCTCCCACTCGAGTGGGAGCACTACAGTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001899.2-297s1c1
Sequence:CCGGGTGAATTACTTCTTCGACGTACTCGAGTACGTCGAAGAAGTAATTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001899.2-441s1c1
Sequence:CCGGGACAGAATGTCCCTGGTGAATCTCGAGATTCACCAGGGACATTCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001899.2-168s1c1
Sequence:CCGGGACCTCAATGATGAGTGGGTACTCGAGTACCCACTCATCATTGAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001899.2-118s1c1
Sequence:CCGGCGAGCTCCAAGGAGGAGAATACTCGAGTATTCTCCTCCTTGGAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001899.2-117s21c1
Sequence:CCGGTCGAGCTCCAAGGAGGAGAATCTCGAGATTCTCCTCCTTGGAGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001899.2-229s21c1
Sequence:CCGGCCACCGAAGATGAGTACTACACTCGAGTGTAGTACTCATCTTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001899.2-203s21c1
Sequence:CCGGCTTCGCCATCAGCGAGTACAACTCGAGTTGTACTCGCTGATGGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001899.2-144s21c1
Sequence:CCGGATCCCAGGTGGCATCTATGATCTCGAGATCATAGATGCCACCTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001899.2-412s21c1
Sequence:CCGGCTTTCGAGATCTACGAAGTTCCTCGAGGAACTTCGTAGATCTCGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001899.2-338s21c1
Sequence:CCGGTACCAAGTCCCAGCCCAACTTCTCGAGAAGTTGGGCTGGGACTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001899.2-362s21c1
Sequence:CCGGCACCTGTGCCTTCCATGAACACTCGAGTGTTCATGGAAGGCACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001899
VALIDATED
CST4 MISSION shRNA Lentiviral Transduction Particles
cystatin S
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001899.2-523s1c1
Sequence:CCGGCCACCCACTGTAGTGCTCCCACTCGAGTGGGAGCACTACAGTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001899.2-297s1c1
Sequence:CCGGGTGAATTACTTCTTCGACGTACTCGAGTACGTCGAAGAAGTAATTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001899.2-441s1c1
Sequence:CCGGGACAGAATGTCCCTGGTGAATCTCGAGATTCACCAGGGACATTCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001899.2-168s1c1
Sequence:CCGGGACCTCAATGATGAGTGGGTACTCGAGTACCCACTCATCATTGAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001899.2-118s1c1
Sequence:CCGGCGAGCTCCAAGGAGGAGAATACTCGAGTATTCTCCTCCTTGGAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001899.2-117s21c1
Sequence:CCGGTCGAGCTCCAAGGAGGAGAATCTCGAGATTCTCCTCCTTGGAGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001899.2-229s21c1
Sequence:CCGGCCACCGAAGATGAGTACTACACTCGAGTGTAGTACTCATCTTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001899.2-203s21c1
Sequence:CCGGCTTCGCCATCAGCGAGTACAACTCGAGTTGTACTCGCTGATGGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001899.2-144s21c1
Sequence:CCGGATCCCAGGTGGCATCTATGATCTCGAGATCATAGATGCCACCTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001899.2-412s21c1
Sequence:CCGGCTTTCGAGATCTACGAAGTTCCTCGAGGAACTTCGTAGATCTCGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001899.2-338s21c1
Sequence:CCGGTACCAAGTCCCAGCCCAACTTCTCGAGAAGTTGGGCTGGGACTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001899.2-362s21c1
Sequence:CCGGCACCTGTGCCTTCCATGAACACTCGAGTGTTCATGGAAGGCACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks