EMAIL THIS PAGE TO A FRIEND

CST5

cystatin D

32 Gene Product Result for
UniProtKB ID: P28325, Q5JRF5, Q9UCA0
Gene ID:
Human(1473) Summary: The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a protein found in saliva and tears. The encoded protein may play a protective role against proteinases present in the oral cavity. [provided by RefSeq, Jul 2008]
Rat(366219) cystatin D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001900 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001900 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001900 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010481 MISSION® esiRNA esiRNA targeting human CST5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001900 Rosetta Predictions human pricing
NM_001108961 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015405 predicted 221
2 SASI_Hs01_00015406 predicted 496
3 SASI_Hs01_00015407 predicted 414
4 SASI_Hs01_00015408 predicted 223
5 SASI_Hs01_00015409 predicted 377
6 SASI_Hs01_00015410 predicted 225
7 SASI_Hs01_00015412 predicted 333
8 SASI_Hs01_00015413 predicted 323
9 SASI_Hs01_00015414 predicted 219
10 SASI_Hs02_00332774 predicted 502
11 SASI_Hs01_00015411 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108961 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243794 predicted 401
2 SASI_Rn02_00243795 predicted 520
3 SASI_Rn02_00243796 predicted 192
4 SASI_Rn02_00243797 predicted 345
5 SASI_Rn02_00243798 predicted 492
6 SASI_Rn02_00243799 predicted 324
7 SASI_Rn02_00243800 predicted 479
8 SASI_Rn02_00243801 predicted 336
9 SASI_Rn02_00243802 predicted 395
10 SASI_Rn02_00243803 predicted 422
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001900
CST5 MISSION shRNA Bacterial Glycerol Stock
cystatin D
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001900.4-309s21c1
Sequence:CCGGGGGTGAACTACTACTTCAATGCTCGAGCATTGAAGTAGTAGTTCACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001900.4-420s21c1
Sequence:CCGGTCTGCTCTTTCCAGATCAATGCTCGAGCATTGATCTGGAAAGAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001900.4-169s21c1
Sequence:CCGGCCATGCCACAGACCTCAATGACTCGAGTCATTGAGGTCTGTGGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001900.x-276s1c1
Sequence:CCGGGTCGAACCACATGCACCAAGTCTCGAGACTTGGTGCATGTGGTTCGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001900.x-163s1c1
Sequence:CCGGCGAGTACAACAAGGTCATTAACTCGAGTTAATGACCTTGTTGTACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001900.x-161s1c1
Sequence:CCGGAGCGAGTACAACAAGGTCATTCTCGAGAATGACCTTGTTGTACTCGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001900.x-162s1c1
Sequence:CCGGGCGAGTACAACAAGGTCATTACTCGAGTAATGACCTTGTTGTACTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001900.x-412s1c1
Sequence:CCGGCTACAAGTGCCGGAAAGTCTACTCGAGTAGACTTTCCGGCACTTGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001900
CST5 MISSION shRNA shRNA Plasmid DNA
cystatin D
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001900.4-309s21c1
Sequence:CCGGGGGTGAACTACTACTTCAATGCTCGAGCATTGAAGTAGTAGTTCACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001900.4-420s21c1
Sequence:CCGGTCTGCTCTTTCCAGATCAATGCTCGAGCATTGATCTGGAAAGAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001900.4-169s21c1
Sequence:CCGGCCATGCCACAGACCTCAATGACTCGAGTCATTGAGGTCTGTGGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001900.x-276s1c1
Sequence:CCGGGTCGAACCACATGCACCAAGTCTCGAGACTTGGTGCATGTGGTTCGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001900.x-163s1c1
Sequence:CCGGCGAGTACAACAAGGTCATTAACTCGAGTTAATGACCTTGTTGTACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001900.x-161s1c1
Sequence:CCGGAGCGAGTACAACAAGGTCATTCTCGAGAATGACCTTGTTGTACTCGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001900.x-162s1c1
Sequence:CCGGGCGAGTACAACAAGGTCATTACTCGAGTAATGACCTTGTTGTACTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001900.x-412s1c1
Sequence:CCGGCTACAAGTGCCGGAAAGTCTACTCGAGTAGACTTTCCGGCACTTGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001900
CST5 MISSION shRNA Lentiviral Transduction Particles
cystatin D
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001900.4-309s21c1
Sequence:CCGGGGGTGAACTACTACTTCAATGCTCGAGCATTGAAGTAGTAGTTCACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001900.4-420s21c1
Sequence:CCGGTCTGCTCTTTCCAGATCAATGCTCGAGCATTGATCTGGAAAGAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001900.4-169s21c1
Sequence:CCGGCCATGCCACAGACCTCAATGACTCGAGTCATTGAGGTCTGTGGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001900.x-276s1c1
Sequence:CCGGGTCGAACCACATGCACCAAGTCTCGAGACTTGGTGCATGTGGTTCGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001900.x-163s1c1
Sequence:CCGGCGAGTACAACAAGGTCATTAACTCGAGTTAATGACCTTGTTGTACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001900.x-161s1c1
Sequence:CCGGAGCGAGTACAACAAGGTCATTCTCGAGAATGACCTTGTTGTACTCGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001900.x-162s1c1
Sequence:CCGGGCGAGTACAACAAGGTCATTACTCGAGTAATGACCTTGTTGTACTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001900.x-412s1c1
Sequence:CCGGCTACAAGTGCCGGAAAGTCTACTCGAGTAGACTTTCCGGCACTTGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)