EMAIL THIS PAGE TO A FRIEND

CST6

cystatin E/M

UniProtKB ID: Q15828, Q540N7
Gene ID:
Human(1474) Summary: The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions, where they appear to provide protective functions. This gene encodes a cystatin from the type 2 family, which is down-regulated in metastatic breast tumor cells as compared to primary tumor cells. Loss of expression is likely associated with the progression of a primary tumor to a metastatic phenotype. [provided by RefSeq, Jul 2008]
Mouse(73720) cystatin E/M
Rat(171096) cystatin E/M
sheep(101112685) cystatin E/M
dog(483719) cystatin E/M
cow(503685) cystatin E/M
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001323 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001323 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001323 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028623 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028623 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028623 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000511 MISSION® esiRNA esiRNA targeting human CST6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001323 Rosetta Predictions human pricing
NM_133566 Rosetta Predictions rat pricing
NM_028623 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068435 predicted 297
2 SASI_Hs01_00068436 predicted 210
3 SASI_Hs01_00068437 predicted 261
4 SASI_Hs01_00068439 predicted 204
5 SASI_Hs01_00068440 predicted 220
6 SASI_Hs01_00068441 predicted 251
7 SASI_Hs01_00068442 predicted 238
8 SASI_Hs01_00068443 predicted 237
9 SASI_Hs01_00068444 predicted 212
10 SASI_Hs02_00331625 predicted 209
11 SASI_Hs01_00068438 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133566 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076538 predicted 439
2 SASI_Rn01_00076539 predicted 529
3 SASI_Rn01_00076540 predicted 381
4 SASI_Rn01_00076541 predicted 425
5 SASI_Rn01_00076542 predicted 522
6 SASI_Rn01_00076543 predicted 466
7 SASI_Rn01_00076544 predicted 377
8 SASI_Rn01_00076545 predicted 455
9 SASI_Rn01_00076546 predicted 582
10 SASI_Rn01_00076547 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028623 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106073 predicted 429
2 SASI_Mm01_00106074 predicted 434
3 SASI_Mm01_00106079 predicted 651
4 SASI_Mm02_00334124 predicted 778
5 SASI_Mm02_00334125 predicted 755
6 SASI_Mm01_00106080 predicted 776
7 SASI_Mm02_00334126 predicted 795
8 SASI_Mm02_00334127 predicted 597
9 SASI_Mm02_00334128 predicted 277
10 SASI_Mm02_00334129 predicted 409
11 SASI_Mm01_00106072 predicted 1139
12 SASI_Mm01_00106075 predicted 1016
13 SASI_Mm01_00106076 predicted 1087
14 SASI_Mm01_00106077 predicted 1078
15 SASI_Mm01_00106078 predicted 1171
16 SASI_Mm01_00106081 predicted 1021
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001323
VALIDATED
CST6 MISSION shRNA Bacterial Glycerol Stock
cystatin E/M
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001323.x-423s1c1
Sequence:CCGGGCTGCGCTGTGACTTTGAGGTCTCGAGACCTCAAAGTCACAGCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001323.x-245s1c1
Sequence:CCGGACAGCATCTACTACTTCCGAGCTCGAGCTCGGAAGTAGTAGATGCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001323.x-252s1c1
Sequence:CCGGCTACTACTTCCGAGACACGCACTCGAGTGCGTGTCTCGGAAGTAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001323.x-258s1c1
Sequence:CCGGCTTCCGAGACACGCACATCATCTCGAGATGATGTGCGTGTCTCGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001323.x-261s1c1
Sequence:CCGGCCGAGACACGCACATCATCAACTCGAGTTGATGATGTGCGTGTCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001323.2-446s21c1
Sequence:CCGGTTGTGGTTCCCTGGCAGAACTCTCGAGAGTTCTGCCAGGGAACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001323.2-309s21c1
Sequence:CCGGCAAGTACTTCCTGACGATGGACTCGAGTCCATCGTCAGGAAGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001323.2-371s21c1
Sequence:CCGGACCACGTCGACCTCACCACTTCTCGAGAAGTGGTGAGGTCGACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001323
VALIDATED
CST6 MISSION shRNA shRNA Plasmid DNA
cystatin E/M
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001323.x-423s1c1
Sequence:CCGGGCTGCGCTGTGACTTTGAGGTCTCGAGACCTCAAAGTCACAGCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001323.x-245s1c1
Sequence:CCGGACAGCATCTACTACTTCCGAGCTCGAGCTCGGAAGTAGTAGATGCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001323.x-252s1c1
Sequence:CCGGCTACTACTTCCGAGACACGCACTCGAGTGCGTGTCTCGGAAGTAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001323.x-258s1c1
Sequence:CCGGCTTCCGAGACACGCACATCATCTCGAGATGATGTGCGTGTCTCGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001323.x-261s1c1
Sequence:CCGGCCGAGACACGCACATCATCAACTCGAGTTGATGATGTGCGTGTCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001323.2-446s21c1
Sequence:CCGGTTGTGGTTCCCTGGCAGAACTCTCGAGAGTTCTGCCAGGGAACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001323.2-309s21c1
Sequence:CCGGCAAGTACTTCCTGACGATGGACTCGAGTCCATCGTCAGGAAGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001323.2-371s21c1
Sequence:CCGGACCACGTCGACCTCACCACTTCTCGAGAAGTGGTGAGGTCGACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001323
VALIDATED
CST6 MISSION shRNA Lentiviral Transduction Particles
cystatin E/M
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001323.x-423s1c1
Sequence:CCGGGCTGCGCTGTGACTTTGAGGTCTCGAGACCTCAAAGTCACAGCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001323.x-245s1c1
Sequence:CCGGACAGCATCTACTACTTCCGAGCTCGAGCTCGGAAGTAGTAGATGCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001323.x-252s1c1
Sequence:CCGGCTACTACTTCCGAGACACGCACTCGAGTGCGTGTCTCGGAAGTAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001323.x-258s1c1
Sequence:CCGGCTTCCGAGACACGCACATCATCTCGAGATGATGTGCGTGTCTCGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001323.x-261s1c1
Sequence:CCGGCCGAGACACGCACATCATCAACTCGAGTTGATGATGTGCGTGTCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001323.2-446s21c1
Sequence:CCGGTTGTGGTTCCCTGGCAGAACTCTCGAGAGTTCTGCCAGGGAACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001323.2-309s21c1
Sequence:CCGGCAAGTACTTCCTGACGATGGACTCGAGTCCATCGTCAGGAAGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001323.2-371s21c1
Sequence:CCGGACCACGTCGACCTCACCACTTCTCGAGAAGTGGTGAGGTCGACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028623
VALIDATED
CST6 MISSION shRNA Bacterial Glycerol Stock
cystatin E/M
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028623.2-1845s1c1
Sequence:CCGGGCTCTGGGAAAGATTCCTAAACTCGAGTTTAGGAATCTTTCCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028623.2-617s1c1
Sequence:CCGGTGCAACTTTGAGCTCCTTGAACTCGAGTTCAAGGAGCTCAAAGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028623.2-454s1c1
Sequence:CCGGCACCAAAGTCATCGATGCAAACTCGAGTTTGCATCGATGACTTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028623.2-499s1c1
Sequence:CCGGGTACTACCTGACTTTGGACATCTCGAGATGTCCAAAGTCAGGTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028623.2-614s1c1
Sequence:CCGGCGTTGCAACTTTGAGCTCCTTCTCGAGAAGGAGCTCAAAGTTGCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028623
VALIDATED
CST6 MISSION shRNA shRNA Plasmid DNA
cystatin E/M
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028623.2-1845s1c1
Sequence:CCGGGCTCTGGGAAAGATTCCTAAACTCGAGTTTAGGAATCTTTCCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028623.2-617s1c1
Sequence:CCGGTGCAACTTTGAGCTCCTTGAACTCGAGTTCAAGGAGCTCAAAGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028623.2-454s1c1
Sequence:CCGGCACCAAAGTCATCGATGCAAACTCGAGTTTGCATCGATGACTTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028623.2-499s1c1
Sequence:CCGGGTACTACCTGACTTTGGACATCTCGAGATGTCCAAAGTCAGGTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028623.2-614s1c1
Sequence:CCGGCGTTGCAACTTTGAGCTCCTTCTCGAGAAGGAGCTCAAAGTTGCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028623
VALIDATED
CST6 MISSION shRNA Lentiviral Transduction Particles
cystatin E/M
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028623.2-1845s1c1
Sequence:CCGGGCTCTGGGAAAGATTCCTAAACTCGAGTTTAGGAATCTTTCCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028623.2-617s1c1
Sequence:CCGGTGCAACTTTGAGCTCCTTGAACTCGAGTTCAAGGAGCTCAAAGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028623.2-454s1c1
Sequence:CCGGCACCAAAGTCATCGATGCAAACTCGAGTTTGCATCGATGACTTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028623.2-499s1c1
Sequence:CCGGGTACTACCTGACTTTGGACATCTCGAGATGTCCAAAGTCAGGTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028623.2-614s1c1
Sequence:CCGGCGTTGCAACTTTGAGCTCCTTCTCGAGAAGGAGCTCAAAGTTGCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks