EMAIL THIS PAGE TO A FRIEND

CST7

cystatin F (leukocystatin)

Synonyms: CMAP
UniProtKB ID: O76096, Q6FH95, Q7Z4J8, Q9UED4
Gene ID:
Human(8530) Summary: The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. This gene encodes a glycosylated cysteine protease inhibitor with a putative role in immune regulation through inhibition of a unique target in the hematopoietic system. Expression of the protein has been observed in various human cancer cell lines established from malignant tumors. [provided by RefSeq, Jul 2008]
Mouse(13011) cystatin F (leukocystatin)
Rat(296257) cystatin F (leukocystatin)
chicken(416716) cystatin F (leukocystatin)
cow(617799) cystatin F (leukocystatin)
domestic cat(101089847) cystatin F (leukocystatin)
dog(485563) cystatin F (leukocystatin)
naked mole-rat(101719757) cystatin F (leukocystatin)
domestic guinea pig(100732414) cystatin F (leukocystatin)
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003650 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003650 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003650 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009977 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009977 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009977 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040111 MISSION® esiRNA esiRNA human CST7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003650 Rosetta Predictions human pricing
NM_001106523 Rosetta Predictions rat pricing
NM_009977 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126985 predicted 354
2 SASI_Hs01_00126987 predicted 547
3 SASI_Hs02_00336017 predicted 515
4 SASI_Hs01_00126988 predicted 526
5 SASI_Hs01_00126989 predicted 500
6 SASI_Hs01_00126990 predicted 300
7 SASI_Hs02_00336018 predicted 686
8 SASI_Hs01_00126991 predicted 454
9 SASI_Hs02_00336019 predicted 556
10 SASI_Hs01_00126992 predicted 428
11 SASI_Hs01_00126986 predicted 373
12 SASI_Hs01_00126993 predicted 510
13 SASI_Hs01_00126994 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106523 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219798 predicted 875
2 SASI_Rn02_00219799 predicted 809
3 SASI_Rn02_00219800 predicted 817
4 SASI_Rn02_00219801 predicted 446
5 SASI_Rn02_00219802 predicted 392
6 SASI_Rn02_00219803 predicted 677
7 SASI_Rn02_00219804 predicted 269
8 SASI_Rn02_00219805 predicted 538
9 SASI_Rn02_00219806 predicted 444
10 SASI_Rn02_00219807 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009977 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043330 predicted 435
2 SASI_Mm01_00043331 predicted 326
3 SASI_Mm01_00043333 predicted 693
4 SASI_Mm01_00043334 predicted 614
5 SASI_Mm01_00043335 predicted 623
6 SASI_Mm01_00043336 predicted 325
7 SASI_Mm01_00043337 predicted 209
8 SASI_Mm02_00317569 predicted 536
9 SASI_Mm01_00043338 predicted 534
10 SASI_Mm01_00043339 predicted 428
11 SASI_Mm01_00043332 predicted 266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003650
CST7 MISSION shRNA Bacterial Glycerol Stock
cystatin F (leukocystatin)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003650.2-485s21c1
Sequence:CCGGTCAAGGAGTCCCGCATCACAACTCGAGTTGTGATGCGGGACTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003650.2-458s21c1
Sequence:CCGGACAACTGCACGAACGACATGTCTCGAGACATGTCGTTCGTGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003650.2-739s1c1
Sequence:CCGGAGCCATGACAAACACCAGGATCTCGAGATCCTGGTGTTTGTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003650.2-430s1c1
Sequence:CCGGGCAGCCAGATACAGTGTTGAACTCGAGTTCAACACTGTATCTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003650.2-370s1c1
Sequence:CCGGTCACGTGTGAAGCCAGGATTTCTCGAGAAATCCTGGCTTCACACGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003650.2-612s1c1
Sequence:CCGGCCAAACCAACCACACCTTGAACTCGAGTTCAAGGTGTGGTTGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003650
CST7 MISSION shRNA shRNA Plasmid DNA
cystatin F (leukocystatin)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003650.2-485s21c1
Sequence:CCGGTCAAGGAGTCCCGCATCACAACTCGAGTTGTGATGCGGGACTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003650.2-458s21c1
Sequence:CCGGACAACTGCACGAACGACATGTCTCGAGACATGTCGTTCGTGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003650.2-739s1c1
Sequence:CCGGAGCCATGACAAACACCAGGATCTCGAGATCCTGGTGTTTGTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003650.2-430s1c1
Sequence:CCGGGCAGCCAGATACAGTGTTGAACTCGAGTTCAACACTGTATCTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003650.2-370s1c1
Sequence:CCGGTCACGTGTGAAGCCAGGATTTCTCGAGAAATCCTGGCTTCACACGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003650.2-612s1c1
Sequence:CCGGCCAAACCAACCACACCTTGAACTCGAGTTCAAGGTGTGGTTGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003650
CST7 MISSION shRNA Lentiviral Transduction Particles
cystatin F (leukocystatin)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003650.2-485s21c1
Sequence:CCGGTCAAGGAGTCCCGCATCACAACTCGAGTTGTGATGCGGGACTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003650.2-458s21c1
Sequence:CCGGACAACTGCACGAACGACATGTCTCGAGACATGTCGTTCGTGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003650.2-739s1c1
Sequence:CCGGAGCCATGACAAACACCAGGATCTCGAGATCCTGGTGTTTGTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003650.2-430s1c1
Sequence:CCGGGCAGCCAGATACAGTGTTGAACTCGAGTTCAACACTGTATCTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003650.2-370s1c1
Sequence:CCGGTCACGTGTGAAGCCAGGATTTCTCGAGAAATCCTGGCTTCACACGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003650.2-612s1c1
Sequence:CCGGCCAAACCAACCACACCTTGAACTCGAGTTCAAGGTGTGGTTGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009977
CST7 MISSION shRNA Bacterial Glycerol Stock
cystatin F (leukocystatin)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009977.1-397s1c1
Sequence:CCGGCCAACTGGACAACTGTGACTTCTCGAGAAGTCACAGTTGTCCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009977.1-314s1c1
Sequence:CCGGGCCCTGGTACAGGTGGTGAAACTCGAGTTTCACCACCTGTACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009977.1-337s1c1
Sequence:CCGGCCTGAAATATATGCTGGAGGTCTCGAGACCTCCAGCATATATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009977.1-57s1c1
Sequence:CCGGCACTACATGCTCCCTGCATTTCTCGAGAAATGCAGGGAGCATGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009977.1-440s1c1
Sequence:CCGGCGGACTCTATATTGCTACTCTCTCGAGAGAGTAGCAATATAGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009977
CST7 MISSION shRNA shRNA Plasmid DNA
cystatin F (leukocystatin)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009977.1-397s1c1
Sequence:CCGGCCAACTGGACAACTGTGACTTCTCGAGAAGTCACAGTTGTCCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009977.1-314s1c1
Sequence:CCGGGCCCTGGTACAGGTGGTGAAACTCGAGTTTCACCACCTGTACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009977.1-337s1c1
Sequence:CCGGCCTGAAATATATGCTGGAGGTCTCGAGACCTCCAGCATATATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009977.1-57s1c1
Sequence:CCGGCACTACATGCTCCCTGCATTTCTCGAGAAATGCAGGGAGCATGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009977.1-440s1c1
Sequence:CCGGCGGACTCTATATTGCTACTCTCTCGAGAGAGTAGCAATATAGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009977
CST7 MISSION shRNA Lentiviral Transduction Particles
cystatin F (leukocystatin)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009977.1-397s1c1
Sequence:CCGGCCAACTGGACAACTGTGACTTCTCGAGAAGTCACAGTTGTCCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009977.1-314s1c1
Sequence:CCGGGCCCTGGTACAGGTGGTGAAACTCGAGTTTCACCACCTGTACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009977.1-337s1c1
Sequence:CCGGCCTGAAATATATGCTGGAGGTCTCGAGACCTCCAGCATATATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009977.1-57s1c1
Sequence:CCGGCACTACATGCTCCCTGCATTTCTCGAGAAATGCAGGGAGCATGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009977.1-440s1c1
Sequence:CCGGCGGACTCTATATTGCTACTCTCTCGAGAGAGTAGCAATATAGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks