EMAIL THIS PAGE TO A FRIEND

CST8

cystatin 8 (cystatin-related epididymal specific)

54 Gene Product Result for
Synonyms: CRES CTES5
UniProtKB ID: O60676, Q2M2X6
Gene ID:
Human(10047) Summary: The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a protein similar to type 2 cystatins. The protein exhibits highly tissue-specific expression in the reproductive tract, suggesting implicit roles in reproduction. Alternative splicing identified in mouse is suggested in human based on EST evidence but the full-length nature of putative variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(13012) cystatin 8 (cystatin-related epididymal spermatogenic)
Rat(29679) cystatin 8 (cystatin-related epididymal specific)
domestic guinea pig(100713218) cystatin 8 (cystatin-related epididymal specific)
naked mole-rat(101704050) cystatin 8 (cystatin-related epididymal specific)
sheep(101104518) cystatin 8 (cystatin-related epididymal specific)
cow(617395) cystatin 8 (cystatin-related epididymal specific)
domestic cat(101087829) cystatin 8 (cystatin-related epididymal specific)
dog(485735) cystatin 8 (cystatin-related epididymal specific)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009978 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009978 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009978 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005492 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005492 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005492 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005492 Rosetta Predictions human pricing
NM_019258 Rosetta Predictions rat pricing
NM_009978 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238866 predicted 625
2 SASI_Hs01_00238867 predicted 641
3 SASI_Hs01_00238868 predicted 585
4 SASI_Hs01_00238869 predicted 495
5 SASI_Hs01_00238870 predicted 474
6 SASI_Hs02_00339686 predicted 506
7 SASI_Hs01_00238871 predicted 612
8 SASI_Hs01_00238872 predicted 646
9 SASI_Hs01_00238873 predicted 589
10 SASI_Hs01_00238875 predicted 484
11 SASI_Hs01_00238874 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019258 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049366 predicted 199
2 SASI_Rn01_00049367 predicted 325
3 SASI_Rn01_00049368 predicted 403
4 SASI_Rn01_00049369 predicted 478
5 SASI_Rn01_00049370 predicted 279
6 SASI_Rn01_00049371 predicted 252
7 SASI_Rn01_00049372 predicted 242
8 SASI_Rn02_00262143 predicted 369
9 SASI_Rn01_00049374 predicted 447
10 SASI_Rn01_00049375 predicted 450
11 SASI_Rn01_00049373 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009978 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185840 predicted 281
2 SASI_Mm01_00185841 predicted 284
3 SASI_Mm01_00185842 predicted 282
4 SASI_Mm01_00185843 predicted 283
5 SASI_Mm01_00185844 predicted 283
6 SASI_Mm01_00185845 predicted 262
7 SASI_Mm01_00185846 predicted 241
8 SASI_Mm01_00185847 predicted 286
9 SASI_Mm01_00185848 predicted 197
10 SASI_Mm01_00185849 predicted 282
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009978
CST8 MISSION shRNA Bacterial Glycerol Stock
cystatin 8 (cystatin-related epididymal specific)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009978.1-329s1c1
Sequence:CCGGGCAGTGTGTTTGGTTTGCCATCTCGAGATGGCAAACCAAACACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009978.1-429s1c1
Sequence:CCGGGACCGAATGGAATACCAAATTCTCGAGAATTTGGTATTCCATTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009978.1-333s1c1
Sequence:CCGGTGTGTTTGGTTTGCCATGAAACTCGAGTTTCATGGCAAACCAAACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009978.1-427s1c1
Sequence:CCGGCAGACCGAATGGAATACCAAACTCGAGTTTGGTATTCCATTCGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009978.1-372s1c1
Sequence:CCGGGAGGACAAATATGTCTTCCTTCTCGAGAAGGAAGACATATTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009978
CST8 MISSION shRNA shRNA Plasmid DNA
cystatin 8 (cystatin-related epididymal specific)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009978.1-329s1c1
Sequence:CCGGGCAGTGTGTTTGGTTTGCCATCTCGAGATGGCAAACCAAACACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009978.1-429s1c1
Sequence:CCGGGACCGAATGGAATACCAAATTCTCGAGAATTTGGTATTCCATTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009978.1-333s1c1
Sequence:CCGGTGTGTTTGGTTTGCCATGAAACTCGAGTTTCATGGCAAACCAAACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009978.1-427s1c1
Sequence:CCGGCAGACCGAATGGAATACCAAACTCGAGTTTGGTATTCCATTCGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009978.1-372s1c1
Sequence:CCGGGAGGACAAATATGTCTTCCTTCTCGAGAAGGAAGACATATTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009978
CST8 MISSION shRNA Lentiviral Transduction Particles
cystatin 8 (cystatin-related epididymal specific)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009978.1-329s1c1
Sequence:CCGGGCAGTGTGTTTGGTTTGCCATCTCGAGATGGCAAACCAAACACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009978.1-429s1c1
Sequence:CCGGGACCGAATGGAATACCAAATTCTCGAGAATTTGGTATTCCATTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009978.1-333s1c1
Sequence:CCGGTGTGTTTGGTTTGCCATGAAACTCGAGTTTCATGGCAAACCAAACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009978.1-427s1c1
Sequence:CCGGCAGACCGAATGGAATACCAAACTCGAGTTTGGTATTCCATTCGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009978.1-372s1c1
Sequence:CCGGGAGGACAAATATGTCTTCCTTCTCGAGAAGGAAGACATATTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005492
CST8 MISSION shRNA Bacterial Glycerol Stock
cystatin 8 (cystatin-related epididymal specific)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005492.2-587s1c1
Sequence:CCGGAGGTCACAAATCTTCTGGAATCTCGAGATTCCAGAAGATTTGTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005492.2-525s1c1
Sequence:CCGGCAACAAAGAGAGCGAGGACAACTCGAGTTGTCCTCGCTCTCTTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005492.2-537s1c1
Sequence:CCGGCGAGGACAAGTATGTCTTCCTCTCGAGAGGAAGACATACTTGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005492.2-643s1c1
Sequence:CCGGAGAAAGCCTTTAAGCACTAATCTCGAGATTAGTGCTTAAAGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005492.2-648s1c1
Sequence:CCGGGCCTTTAAGCACTAATGAAATCTCGAGATTTCATTAGTGCTTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005492.2-465s21c1
Sequence:CCGGACCCGTCAATGCCTCAAATGCCTCGAGGCATTTGAGGCATTGACGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005492.2-662s21c1
Sequence:CCGGATGAAATCTGCGCCATTCAAGCTCGAGCTTGAATGGCGCAGATTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005492.2-608s21c1
Sequence:CCGGACCTTATTGATGTAGAAATTGCTCGAGCAATTTCTACATCAATAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005492.2-504s21c1
Sequence:CCGGGTGGTTTGCCATGCAAGAATACTCGAGTATTCTTGCATGGCAAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005492.2-621s21c1
Sequence:CCGGAGAAATTGCCCGCAGCGATTGCTCGAGCAATCGCTGCGGGCAATTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005492
CST8 MISSION shRNA shRNA Plasmid DNA
cystatin 8 (cystatin-related epididymal specific)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005492.2-587s1c1
Sequence:CCGGAGGTCACAAATCTTCTGGAATCTCGAGATTCCAGAAGATTTGTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005492.2-525s1c1
Sequence:CCGGCAACAAAGAGAGCGAGGACAACTCGAGTTGTCCTCGCTCTCTTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005492.2-537s1c1
Sequence:CCGGCGAGGACAAGTATGTCTTCCTCTCGAGAGGAAGACATACTTGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005492.2-643s1c1
Sequence:CCGGAGAAAGCCTTTAAGCACTAATCTCGAGATTAGTGCTTAAAGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005492.2-648s1c1
Sequence:CCGGGCCTTTAAGCACTAATGAAATCTCGAGATTTCATTAGTGCTTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005492.2-465s21c1
Sequence:CCGGACCCGTCAATGCCTCAAATGCCTCGAGGCATTTGAGGCATTGACGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005492.2-662s21c1
Sequence:CCGGATGAAATCTGCGCCATTCAAGCTCGAGCTTGAATGGCGCAGATTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005492.2-608s21c1
Sequence:CCGGACCTTATTGATGTAGAAATTGCTCGAGCAATTTCTACATCAATAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005492.2-504s21c1
Sequence:CCGGGTGGTTTGCCATGCAAGAATACTCGAGTATTCTTGCATGGCAAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005492.2-621s21c1
Sequence:CCGGAGAAATTGCCCGCAGCGATTGCTCGAGCAATCGCTGCGGGCAATTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005492
CST8 MISSION shRNA Lentiviral Transduction Particles
cystatin 8 (cystatin-related epididymal specific)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005492.2-587s1c1
Sequence:CCGGAGGTCACAAATCTTCTGGAATCTCGAGATTCCAGAAGATTTGTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005492.2-525s1c1
Sequence:CCGGCAACAAAGAGAGCGAGGACAACTCGAGTTGTCCTCGCTCTCTTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005492.2-537s1c1
Sequence:CCGGCGAGGACAAGTATGTCTTCCTCTCGAGAGGAAGACATACTTGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005492.2-643s1c1
Sequence:CCGGAGAAAGCCTTTAAGCACTAATCTCGAGATTAGTGCTTAAAGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005492.2-648s1c1
Sequence:CCGGGCCTTTAAGCACTAATGAAATCTCGAGATTTCATTAGTGCTTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005492.2-465s21c1
Sequence:CCGGACCCGTCAATGCCTCAAATGCCTCGAGGCATTTGAGGCATTGACGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005492.2-662s21c1
Sequence:CCGGATGAAATCTGCGCCATTCAAGCTCGAGCTTGAATGGCGCAGATTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005492.2-608s21c1
Sequence:CCGGACCTTATTGATGTAGAAATTGCTCGAGCAATTTCTACATCAATAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005492.2-504s21c1
Sequence:CCGGGTGGTTTGCCATGCAAGAATACTCGAGTATTCTTGCATGGCAAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005492.2-621s21c1
Sequence:CCGGAGAAATTGCCCGCAGCGATTGCTCGAGCAATCGCTGCGGGCAATTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks