EMAIL THIS PAGE TO A FRIEND

CST9

cystatin 9 (testatin)

40 Gene Product Result for
Synonyms: CLM CTES7A
UniProtKB ID: Q5W186, B2RP76, Q8TD53
Gene ID:
Human(128822) Summary: The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions, where they appear to provide protective functions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a secreted protein that may play a role in hematopoietic differentiation or inflammation. [provided by RefSeq, Jul 2008]
Mouse(13013) cystatin 9
cow(781567) cystatin 9 (testatin)
domestic cat(101089343) cystatin 9 (testatin)
sheep(101103828) cystatin 9 (testatin)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009979 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009979 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009979 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001008693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008693 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120241 MISSION® esiRNA esiRNA human CST9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008693 Rosetta Predictions human pricing
NM_009979 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098807 predicted 599
2 SASI_Hs01_00098808 predicted 858
3 SASI_Hs02_00305525 predicted 641
4 SASI_Hs02_00305526 predicted 375
5 SASI_Hs01_00098809 predicted 577
6 SASI_Hs01_00098810 predicted 307
7 SASI_Hs01_00098811 predicted 698
8 SASI_Hs01_00098812 predicted 585
9 SASI_Hs01_00098813 predicted 304
10 SASI_Hs01_00098814 predicted 439
11 SASI_Hs01_00098815 predicted 274
12 SASI_Hs01_00098816 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009979 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128079 predicted 320
2 SASI_Mm01_00128080 predicted 296
3 SASI_Mm01_00128081 predicted 243
4 SASI_Mm01_00128082 predicted 462
5 SASI_Mm01_00128084 predicted 213
6 SASI_Mm01_00128085 predicted 425
7 SASI_Mm01_00128086 predicted 400
8 SASI_Mm02_00317570 predicted 419
9 SASI_Mm01_00128088 predicted 340
10 SASI_Mm02_00317571 predicted 243
11 SASI_Mm01_00128083 predicted 424
12 SASI_Mm01_00128087 predicted 265
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009979
CST9 MISSION shRNA Bacterial Glycerol Stock
cystatin 9 (testatin)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009979.1-513s1c1
Sequence:CCGGGTACTTCTCTGCATCCGTGAACTCGAGTTCACGGATGCAGAGAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009979.1-322s1c1
Sequence:CCGGGCTGCGTAGAACCATATGCAACTCGAGTTGCATATGGTTCTACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009979.1-385s1c1
Sequence:CCGGCCATGGTCTGAATAATACCTTCTCGAGAAGGTATTATTCAGACCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009979.1-193s1c1
Sequence:CCGGCACAGTGGAATTTGCCGTGAACTCGAGTTCACGGCAAATTCCACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009979.1-143s1c1
Sequence:CCGGCCTGTCTCGAAGGCCAATAAACTCGAGTTTATTGGCCTTCGAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009979
CST9 MISSION shRNA shRNA Plasmid DNA
cystatin 9 (testatin)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009979.1-513s1c1
Sequence:CCGGGTACTTCTCTGCATCCGTGAACTCGAGTTCACGGATGCAGAGAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009979.1-322s1c1
Sequence:CCGGGCTGCGTAGAACCATATGCAACTCGAGTTGCATATGGTTCTACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009979.1-385s1c1
Sequence:CCGGCCATGGTCTGAATAATACCTTCTCGAGAAGGTATTATTCAGACCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009979.1-193s1c1
Sequence:CCGGCACAGTGGAATTTGCCGTGAACTCGAGTTCACGGCAAATTCCACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009979.1-143s1c1
Sequence:CCGGCCTGTCTCGAAGGCCAATAAACTCGAGTTTATTGGCCTTCGAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009979
CST9 MISSION shRNA Lentiviral Transduction Particles
cystatin 9 (testatin)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009979.1-513s1c1
Sequence:CCGGGTACTTCTCTGCATCCGTGAACTCGAGTTCACGGATGCAGAGAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009979.1-322s1c1
Sequence:CCGGGCTGCGTAGAACCATATGCAACTCGAGTTGCATATGGTTCTACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009979.1-385s1c1
Sequence:CCGGCCATGGTCTGAATAATACCTTCTCGAGAAGGTATTATTCAGACCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009979.1-193s1c1
Sequence:CCGGCACAGTGGAATTTGCCGTGAACTCGAGTTCACGGCAAATTCCACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009979.1-143s1c1
Sequence:CCGGCCTGTCTCGAAGGCCAATAAACTCGAGTTTATTGGCCTTCGAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008693
CST9 MISSION shRNA Bacterial Glycerol Stock
cystatin 9 (testatin)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008693.1-1096s1c1
Sequence:CCGGGCCTCAAATCACGTTGTAGTTCTCGAGAACTACAACGTGATTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008693.1-83s1c1
Sequence:CCGGTGGTGACTTATGCCTGGTGTTCTCGAGAACACCAGGCATAAGTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008693.1-310s1c1
Sequence:CCGGCAAACCGTATGTAGGAAATTTCTCGAGAAATTTCCTACATACGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008693.1-108s1c1
Sequence:CCGGAGAGGAAATGGGTGGTAATAACTCGAGTTATTACCACCCATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008693.1-293s1c1
Sequence:CCGGTGAATCTGCAACTGCGCCAAACTCGAGTTTGGCGCAGTTGCAGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008693
CST9 MISSION shRNA shRNA Plasmid DNA
cystatin 9 (testatin)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008693.1-1096s1c1
Sequence:CCGGGCCTCAAATCACGTTGTAGTTCTCGAGAACTACAACGTGATTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008693.1-83s1c1
Sequence:CCGGTGGTGACTTATGCCTGGTGTTCTCGAGAACACCAGGCATAAGTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008693.1-310s1c1
Sequence:CCGGCAAACCGTATGTAGGAAATTTCTCGAGAAATTTCCTACATACGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008693.1-108s1c1
Sequence:CCGGAGAGGAAATGGGTGGTAATAACTCGAGTTATTACCACCCATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008693.1-293s1c1
Sequence:CCGGTGAATCTGCAACTGCGCCAAACTCGAGTTTGGCGCAGTTGCAGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008693
CST9 MISSION shRNA Lentiviral Transduction Particles
cystatin 9 (testatin)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008693.1-1096s1c1
Sequence:CCGGGCCTCAAATCACGTTGTAGTTCTCGAGAACTACAACGTGATTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008693.1-83s1c1
Sequence:CCGGTGGTGACTTATGCCTGGTGTTCTCGAGAACACCAGGCATAAGTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008693.1-310s1c1
Sequence:CCGGCAAACCGTATGTAGGAAATTTCTCGAGAAATTTCCTACATACGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008693.1-108s1c1
Sequence:CCGGAGAGGAAATGGGTGGTAATAACTCGAGTTATTACCACCCATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008693.1-293s1c1
Sequence:CCGGTGAATCTGCAACTGCGCCAAACTCGAGTTTGGCGCAGTTGCAGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks