EMAIL THIS PAGE TO A FRIEND

CST9L

cystatin 9-like

28 Gene Product Result for
Synonyms: CTES7B bA218C14.1
UniProtKB ID: Q9H4G1, B2R5A1
Gene ID:
Human(128821) Summary: The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a protein similar to mouse cystatin 9. Based on its testis-specific expression, it is likely to have a role in tissue reorganization during early testis development. [provided by RefSeq, Jul 2008]
Rat(362231) cystatin 9-like
naked mole-rat(101704762) cystatin 9-like
dog(485559) cystatin 9 (testatin)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301128 Anti-CST9L antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080610 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080610 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080610 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003561 MISSION® esiRNA esiRNA targeting human CST9L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080610 Rosetta Predictions human pricing
NM_001108597 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120033 predicted 478
2 SASI_Hs01_00120034 predicted 582
3 SASI_Hs01_00120035 predicted 447
4 SASI_Hs01_00120036 predicted 539
5 SASI_Hs01_00120037 predicted 392
6 SASI_Hs01_00120038 predicted 403
7 SASI_Hs01_00120039 predicted 542
8 SASI_Hs01_00120040 predicted 480
9 SASI_Hs01_00120041 predicted 361
10 SASI_Hs02_00362356 predicted 370
11 SASI_Hs01_00120032 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108597 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240209 predicted 198
2 SASI_Rn02_00240210 predicted 377
3 SASI_Rn02_00240211 predicted 279
4 SASI_Rn02_00240212 predicted 398
5 SASI_Rn02_00240213 predicted 449
6 SASI_Rn02_00240214 predicted 402
7 SASI_Rn02_00240215 predicted 460
8 SASI_Rn02_00240216 predicted 437
9 SASI_Rn02_00240217 predicted 373
10 SASI_Rn02_00240218 predicted 436
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080610
CST9L MISSION shRNA Bacterial Glycerol Stock
cystatin 9-like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080610.1-314s1c1
Sequence:CCGGGCTGATCTATGCCTGGCATTTCTCGAGAAATGCCAGGCATAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080610.1-590s1c1
Sequence:CCGGGAACAATACTTTCACCTGCTTCTCGAGAAGCAGGTGAAAGTATTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080610.1-719s1c1
Sequence:CCGGGCTCCCACATTCCGTGGACATCTCGAGATGTCCACGGAATGTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080610.1-488s1c1
Sequence:CCGGGTCCAAGACTGTATTCTCAATCTCGAGATTGAGAATACAGTCTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080610.2-417s21c1
Sequence:CCGGCACAATGTCATGGCTCGTTACCTCGAGGTAACGAGCCATGACATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080610.2-730s21c1
Sequence:CCGGAGGGATTCCACTGAGTGAAACCTCGAGGTTTCACTCAGTGGAATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080610.1-419s1c2
Sequence:CCGGCCAACAGAGCAAGGACTACTACTCGAGTAGTAGTCCTTGCTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080610
CST9L MISSION shRNA shRNA Plasmid DNA
cystatin 9-like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080610.1-314s1c1
Sequence:CCGGGCTGATCTATGCCTGGCATTTCTCGAGAAATGCCAGGCATAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080610.1-590s1c1
Sequence:CCGGGAACAATACTTTCACCTGCTTCTCGAGAAGCAGGTGAAAGTATTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080610.1-719s1c1
Sequence:CCGGGCTCCCACATTCCGTGGACATCTCGAGATGTCCACGGAATGTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080610.1-488s1c1
Sequence:CCGGGTCCAAGACTGTATTCTCAATCTCGAGATTGAGAATACAGTCTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080610.2-417s21c1
Sequence:CCGGCACAATGTCATGGCTCGTTACCTCGAGGTAACGAGCCATGACATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080610.2-730s21c1
Sequence:CCGGAGGGATTCCACTGAGTGAAACCTCGAGGTTTCACTCAGTGGAATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080610.1-419s1c2
Sequence:CCGGCCAACAGAGCAAGGACTACTACTCGAGTAGTAGTCCTTGCTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080610
CST9L MISSION shRNA Lentiviral Transduction Particles
cystatin 9-like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080610.1-314s1c1
Sequence:CCGGGCTGATCTATGCCTGGCATTTCTCGAGAAATGCCAGGCATAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080610.1-590s1c1
Sequence:CCGGGAACAATACTTTCACCTGCTTCTCGAGAAGCAGGTGAAAGTATTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080610.1-719s1c1
Sequence:CCGGGCTCCCACATTCCGTGGACATCTCGAGATGTCCACGGAATGTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080610.1-488s1c1
Sequence:CCGGGTCCAAGACTGTATTCTCAATCTCGAGATTGAGAATACAGTCTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080610.2-417s21c1
Sequence:CCGGCACAATGTCATGGCTCGTTACCTCGAGGTAACGAGCCATGACATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080610.2-730s21c1
Sequence:CCGGAGGGATTCCACTGAGTGAAACCTCGAGGTTTCACTCAGTGGAATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080610.1-419s1c2
Sequence:CCGGCCAACAGAGCAAGGACTACTACTCGAGTAGTAGTCCTTGCTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks