EMAIL THIS PAGE TO A FRIEND

CSTA

cystatin A (stefin A)

79 Gene Product Result for
Synonyms: AREI STF1 STFA
UniProtKB ID: P01040
Gene ID:
Human(1475) Summary: The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins, and kininogens. This gene encodes a stefin that functions as a cysteine protease inhibitor, forming tight complexes with papain and the cathepsins B, H, and L. The protein is one of the precursor proteins of cornified cell envelope in keratinocytes and plays a role in epidermal development and maintenance. Stefins have been proposed as prognostic and diagnostic tools for cancer. [provided by RefSeq, Jul 2008]
Mouse(209294) cystatin A
Rat(288067) cystatin A (stefin A)
chicken(418268) cystatin A (stefin A)
domestic cat(493942) cystatin A (stefin A)
cow(617114) cystatin A (stefin A)
dog(488008) cystatin A (stefin A)
domestic guinea pig(100725920) cystatin A (stefin A)
naked mole-rat(101725559) cystatin A (stefin A)
sheep(101112780) cystatin A (stefin A)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005213 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005213 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005213 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_358797 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_358797 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_358797 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058311 MISSION® esiRNA esiRNA human CSTA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005213 Rosetta Predictions human pricing
NM_001105876 Rosetta Predictions rat pricing
NM_001033239 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040269 predicted 482
2 SASI_Hs01_00040270 predicted 276
3 SASI_Hs01_00040271 predicted 367
4 SASI_Hs01_00040272 predicted 321
5 SASI_Hs01_00040273 predicted 466
6 SASI_Hs01_00040274 predicted 464
7 SASI_Hs01_00040275 predicted 437
8 SASI_Hs01_00040276 predicted 490
9 SASI_Hs01_00040277 predicted 591
10 SASI_Hs02_00339190 predicted 432
11 SASI_Hs01_00040278 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105876 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213402 predicted 78
2 SASI_Rn02_00213403 predicted 303
3 SASI_Rn02_00213404 predicted 107
4 SASI_Rn02_00213405 predicted 212
5 SASI_Rn02_00213406 predicted 348
6 SASI_Rn02_00213407 predicted 268
7 SASI_Rn02_00213408 predicted 86
8 SASI_Rn02_00213409 predicted 308
9 SASI_Rn02_00213410 predicted 276
10 SASI_Rn02_00213411 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033239 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155627 predicted 653
2 SASI_Mm01_00155628 predicted 320
3 SASI_Mm01_00155630 predicted 447
4 SASI_Mm01_00155631 predicted 283
5 SASI_Mm01_00155632 predicted 705
6 SASI_Mm01_00155634 predicted 507
7 SASI_Mm01_00155635 predicted 681
8 SASI_Mm01_00155636 predicted 661
9 SASI_Mm02_00288384 predicted 321
10 SASI_Mm02_00288385 predicted 689
11 SASI_Mm01_00155629 predicted 345
12 SASI_Mm01_00155633 predicted 552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005213
VALIDATED
CSTA MISSION shRNA Bacterial Glycerol Stock
cystatin A (stefin A)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005213.3-194s21c1
Sequence:CCGGAGGTTAAACCACAGCTTGAAGCTCGAGCTTCAAGCTGTGGTTTAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005213.3-182s21c1
Sequence:CCGGAGATTGTTGATAAGGTTAAACCTCGAGGTTTAACCTTATCAACAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005213.3-274s21c1
Sequence:CCGGGCTGGAACAAATTACTACATTCTCGAGAATGTAGTAATTTGTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005213.3-595s21c1
Sequence:CCGGGTGTTATTGCTTTAGAGTATACTCGAGTATACTCTAAAGCAATAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005213.3-422s21c1
Sequence:CCGGTTTAGCAGCATGTACCCAAAGCTCGAGCTTTGGGTACATGCTGCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005213.3-375s21c1
Sequence:CCGGTACTGGATACCAGGTTGACAACTCGAGTTGTCAACCTGGTATCCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005213.3-364s21c1
Sequence:CCGGGACTTGGTACTTACTGGATACCTCGAGGTATCCAGTAAGTACCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011048    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005213.2-220s1c1
Sequence:CCGGATTAAGGTACGAGCAGGTGATCTCGAGATCACCTGCTCGTACCTTAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006754    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005213.2-224s1c1
Sequence:CCGGAGGTACGAGCAGGTGATAATACTCGAGTATTATCACCTGCTCGTACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006755    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005213.2-228s1c1
Sequence:CCGGACGAGCAGGTGATAATAAATACTCGAGTATTTATTATCACCTGCTCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006756    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005213.2-219s1c1
Sequence:CCGGCATTAAGGTACGAGCAGGTGACTCGAGTCACCTGCTCGTACCTTAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006757    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005213.2-227s1c1
Sequence:CCGGTACGAGCAGGTGATAATAAATCTCGAGATTTATTATCACCTGCTCGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005213
VALIDATED
CSTA MISSION shRNA shRNA Plasmid DNA
cystatin A (stefin A)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005213.3-194s21c1
Sequence:CCGGAGGTTAAACCACAGCTTGAAGCTCGAGCTTCAAGCTGTGGTTTAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005213.3-182s21c1
Sequence:CCGGAGATTGTTGATAAGGTTAAACCTCGAGGTTTAACCTTATCAACAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005213.3-274s21c1
Sequence:CCGGGCTGGAACAAATTACTACATTCTCGAGAATGTAGTAATTTGTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005213.3-595s21c1
Sequence:CCGGGTGTTATTGCTTTAGAGTATACTCGAGTATACTCTAAAGCAATAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005213.3-422s21c1
Sequence:CCGGTTTAGCAGCATGTACCCAAAGCTCGAGCTTTGGGTACATGCTGCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005213.3-375s21c1
Sequence:CCGGTACTGGATACCAGGTTGACAACTCGAGTTGTCAACCTGGTATCCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005213.3-364s21c1
Sequence:CCGGGACTTGGTACTTACTGGATACCTCGAGGTATCCAGTAAGTACCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011048    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005213.2-220s1c1
Sequence:CCGGATTAAGGTACGAGCAGGTGATCTCGAGATCACCTGCTCGTACCTTAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006754    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005213.2-224s1c1
Sequence:CCGGAGGTACGAGCAGGTGATAATACTCGAGTATTATCACCTGCTCGTACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006755    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005213.2-228s1c1
Sequence:CCGGACGAGCAGGTGATAATAAATACTCGAGTATTTATTATCACCTGCTCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006756    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005213.2-219s1c1
Sequence:CCGGCATTAAGGTACGAGCAGGTGACTCGAGTCACCTGCTCGTACCTTAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006757    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005213.2-227s1c1
Sequence:CCGGTACGAGCAGGTGATAATAAATCTCGAGATTTATTATCACCTGCTCGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005213
VALIDATED
CSTA MISSION shRNA Lentiviral Transduction Particles
cystatin A (stefin A)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005213.3-194s21c1
Sequence:CCGGAGGTTAAACCACAGCTTGAAGCTCGAGCTTCAAGCTGTGGTTTAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005213.3-182s21c1
Sequence:CCGGAGATTGTTGATAAGGTTAAACCTCGAGGTTTAACCTTATCAACAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005213.3-274s21c1
Sequence:CCGGGCTGGAACAAATTACTACATTCTCGAGAATGTAGTAATTTGTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005213.3-595s21c1
Sequence:CCGGGTGTTATTGCTTTAGAGTATACTCGAGTATACTCTAAAGCAATAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005213.3-422s21c1
Sequence:CCGGTTTAGCAGCATGTACCCAAAGCTCGAGCTTTGGGTACATGCTGCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005213.3-375s21c1
Sequence:CCGGTACTGGATACCAGGTTGACAACTCGAGTTGTCAACCTGGTATCCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005213.3-364s21c1
Sequence:CCGGGACTTGGTACTTACTGGATACCTCGAGGTATCCAGTAAGTACCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011048    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005213.2-220s1c1
Sequence:CCGGATTAAGGTACGAGCAGGTGATCTCGAGATCACCTGCTCGTACCTTAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006754    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005213.2-224s1c1
Sequence:CCGGAGGTACGAGCAGGTGATAATACTCGAGTATTATCACCTGCTCGTACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006755    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005213.2-228s1c1
Sequence:CCGGACGAGCAGGTGATAATAAATACTCGAGTATTTATTATCACCTGCTCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006756    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005213.2-219s1c1
Sequence:CCGGCATTAAGGTACGAGCAGGTGACTCGAGTCACCTGCTCGTACCTTAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006757    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005213.2-227s1c1
Sequence:CCGGTACGAGCAGGTGATAATAAATCTCGAGATTTATTATCACCTGCTCGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_358797
CSTA MISSION shRNA Bacterial Glycerol Stock
cystatin A (stefin A)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358797.1-326s1c1
Sequence:CCGGGCTGGAGTCAATTACTTCATTCTCGAGAATGAAGTAATTGACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358797.1-364s1c1
Sequence:CCGGTGGTTGTTTCACCCACATAAACTCGAGTTTATGTGGGTGAAACAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358797.1-257s1c1
Sequence:CCGGCAGCTCGAAGAGGAAACCAATCTCGAGATTGGTTTCCTCTTCGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358797.1-391s1c1
Sequence:CCGGCAAGGATCTTTCTGGAAAGAACTCGAGTTCTTTCCAGAAAGATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358797.1-262s1c1
Sequence:CCGGCGAAGAGGAAACCAATGAGAACTCGAGTTCTCATTGGTTTCCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_358797
CSTA MISSION shRNA shRNA Plasmid DNA
cystatin A (stefin A)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358797.1-326s1c1
Sequence:CCGGGCTGGAGTCAATTACTTCATTCTCGAGAATGAAGTAATTGACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358797.1-364s1c1
Sequence:CCGGTGGTTGTTTCACCCACATAAACTCGAGTTTATGTGGGTGAAACAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358797.1-257s1c1
Sequence:CCGGCAGCTCGAAGAGGAAACCAATCTCGAGATTGGTTTCCTCTTCGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358797.1-391s1c1
Sequence:CCGGCAAGGATCTTTCTGGAAAGAACTCGAGTTCTTTCCAGAAAGATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358797.1-262s1c1
Sequence:CCGGCGAAGAGGAAACCAATGAGAACTCGAGTTCTCATTGGTTTCCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_358797
CSTA MISSION shRNA Lentiviral Transduction Particles
cystatin A (stefin A)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358797.1-326s1c1
Sequence:CCGGGCTGGAGTCAATTACTTCATTCTCGAGAATGAAGTAATTGACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358797.1-364s1c1
Sequence:CCGGTGGTTGTTTCACCCACATAAACTCGAGTTTATGTGGGTGAAACAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358797.1-257s1c1
Sequence:CCGGCAGCTCGAAGAGGAAACCAATCTCGAGATTGGTTTCCTCTTCGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358797.1-391s1c1
Sequence:CCGGCAAGGATCTTTCTGGAAAGAACTCGAGTTCTTTCCAGAAAGATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358797.1-262s1c1
Sequence:CCGGCGAAGAGGAAACCAATGAGAACTCGAGTTCTCATTGGTTTCCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks