EMAIL THIS PAGE TO A FRIEND

CSTB

cystatin B (stefin B)

59 Gene Product Result for
Synonyms: CST6 EPM1 EPM1A PME STFB ULD
UniProtKB ID: P04080
Gene ID:
Human(1476) Summary: The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and kininogens. This gene encodes a stefin that functions as an intracellular thiol protease inhibitor. The protein is able to form a dimer stabilized by noncovalent forces, inhibiting papain and cathepsins l, h and b. The protein is thought to play a role in protecting against the proteases leaking from lysosomes. Evidence indicates that mutations in this gene are responsible for the primary defects in patients with progressive myoclonic epilepsy (EPM1). [provided by RefSeq, Jul 2008]
Mouse(13014) cystatin B
Rat(25308) cystatin B (stefin B)
sheep(101123265) cystatin B (stefin B)
naked mole-rat(101699171) cystatin B (stefin B)
domestic guinea pig(100719016) cystatin B (stefin B)
chicken(418267) cystatin B (stefin B)
dog(478424) cystatin B (stefin B)
cow(512805) cystatin B (stefin B)
cow(514170) cystatin B (stefin B)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV45748 Anti-CSTB (AB1) antibody produced in rabbit affinity isolated antibody rabbit, horse, mouse, rabbit, human, rat, pig
immunohistochemistry, western blot pricing
AV45749 Anti-CSTB (AB2) antibody produced in rabbit affinity isolated antibody mouse, rabbit, human, guinea pig, horse, rabbit, rat, pig, bovine, sheep
western blot pricing
SAB2501912 Anti-CSTB (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human, canine
ELISA, western blot pricing
HPA017380 Anti-CSTB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA058557 Anti-CSTB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4500524 Anti-Stefin B antibody produced in rabbit affinity isolated antibody human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
WH0001476M1 Monoclonal Anti-CSTB antibody produced in mouse clone M1-C1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403707 Monoclonal Anti-CSTB antibody produced in mouse clone M2-F1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
C5243 Monoclonal Anti-Cystatin B antibody produced in mouse ~2 mg/mL, clone RJMW-2E7, purified immunoglobulin, buffered aqueous solution monkey, human
ELISA, immunocytochemistry, immunohistochemistry, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007793 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007793 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007793 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000100 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000100 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000100 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000100 Rosetta Predictions human pricing
NM_012838 Rosetta Predictions rat pricing
NM_007793 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000100 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059287 predicted 312
2 SASI_Hs02_00301868 predicted 312
3 SASI_Hs02_00301869 predicted 341
4 SASI_Hs01_00059290 predicted 384
5 SASI_Hs01_00059291 predicted 376
6 SASI_Hs01_00059292 predicted 282
7 SASI_Hs01_00059293 predicted 257
8 SASI_Hs01_00059295 predicted 215
9 SASI_Hs02_00301870 predicted 282
10 SASI_Hs02_00301871 predicted 300
11 SASI_Hs01_00059286 predicted 203
12 SASI_Hs01_00059288 predicted 372
13 SASI_Hs01_00059289 predicted 343
14 SASI_Hs01_00059294 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012838 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072356 predicted 327
2 SASI_Rn01_00072358 predicted 239
3 SASI_Rn01_00072359 predicted 311
4 SASI_Rn02_00260304 predicted 330
5 SASI_Rn01_00072362 predicted 281
6 SASI_Rn01_00072363 predicted 327
7 SASI_Rn01_00072365 predicted 325
8 SASI_Rn02_00260305 predicted 197
9 SASI_Rn02_00260306 predicted 197
10 SASI_Rn02_00260307 predicted 342
11 SASI_Rn01_00072357 predicted 252
12 SASI_Rn01_00072360 predicted 229
13 SASI_Rn01_00072361 predicted 246
14 SASI_Rn01_00072364 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007793 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056320 predicted 234
2 SASI_Mm01_00056321 predicted 235
3 SASI_Mm01_00056322 predicted 355
4 SASI_Mm01_00056323 predicted 290
5 SASI_Mm01_00056324 predicted 255
6 SASI_Mm01_00056325 predicted 310
7 SASI_Mm01_00056326 predicted 257
8 SASI_Mm01_00056327 predicted 271
9 SASI_Mm01_00056328 predicted 371
10 SASI_Mm01_00056329 predicted 310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007793
VALIDATED
CSTB MISSION shRNA Bacterial Glycerol Stock
cystatin B (stefin B)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007793.3-370s21c1
Sequence:CCGGCTTCCTATCAGACCAACAAAGCTCGAGCTTTGTTGGTCTGATAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007793.3-273s21c1
Sequence:CCGGACCAACCTCTTCATCAAGGTTCTCGAGAACCTTGATGAAGAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007793.3-439s21c1
Sequence:CCGGTGTGTTTGGGACCACGTAGTACTCGAGTACTACGTGGTCCCAAACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007793.3-196s21c1
Sequence:CCGGCCCAGCTTGAATCGAAAGAAACTCGAGTTTCTTTCGATTCAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007793.2-403s1c1
Sequence:CCGGTGTGTTTGGGACCACGTAGTACTCGAGTACTACGTGGTCCCAAACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007793.2-160s1c1
Sequence:CCGGCCCAGCTTGAATCGAAAGAAACTCGAGTTTCTTTCGATTCAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007793.2-345s1c1
Sequence:CCGGACCAACAAAGAAAGGCACGATCTCGAGATCGTGCCTTTCTTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007793.2-266s1c1
Sequence:CCGGTGGAGATAAATGCGTGCACTTCTCGAGAAGTGCACGCATTTATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007793.2-237s1c1
Sequence:CCGGACCAACCTCTTCATCAAGGTTCTCGAGAACCTTGATGAAGAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007793
VALIDATED
CSTB MISSION shRNA shRNA Plasmid DNA
cystatin B (stefin B)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007793.3-370s21c1
Sequence:CCGGCTTCCTATCAGACCAACAAAGCTCGAGCTTTGTTGGTCTGATAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007793.3-273s21c1
Sequence:CCGGACCAACCTCTTCATCAAGGTTCTCGAGAACCTTGATGAAGAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007793.3-439s21c1
Sequence:CCGGTGTGTTTGGGACCACGTAGTACTCGAGTACTACGTGGTCCCAAACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007793.3-196s21c1
Sequence:CCGGCCCAGCTTGAATCGAAAGAAACTCGAGTTTCTTTCGATTCAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007793.2-403s1c1
Sequence:CCGGTGTGTTTGGGACCACGTAGTACTCGAGTACTACGTGGTCCCAAACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007793.2-160s1c1
Sequence:CCGGCCCAGCTTGAATCGAAAGAAACTCGAGTTTCTTTCGATTCAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007793.2-345s1c1
Sequence:CCGGACCAACAAAGAAAGGCACGATCTCGAGATCGTGCCTTTCTTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007793.2-266s1c1
Sequence:CCGGTGGAGATAAATGCGTGCACTTCTCGAGAAGTGCACGCATTTATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007793.2-237s1c1
Sequence:CCGGACCAACCTCTTCATCAAGGTTCTCGAGAACCTTGATGAAGAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007793
VALIDATED
CSTB MISSION shRNA Lentiviral Transduction Particles
cystatin B (stefin B)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007793.3-370s21c1
Sequence:CCGGCTTCCTATCAGACCAACAAAGCTCGAGCTTTGTTGGTCTGATAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007793.3-273s21c1
Sequence:CCGGACCAACCTCTTCATCAAGGTTCTCGAGAACCTTGATGAAGAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007793.3-439s21c1
Sequence:CCGGTGTGTTTGGGACCACGTAGTACTCGAGTACTACGTGGTCCCAAACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007793.3-196s21c1
Sequence:CCGGCCCAGCTTGAATCGAAAGAAACTCGAGTTTCTTTCGATTCAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007793.2-403s1c1
Sequence:CCGGTGTGTTTGGGACCACGTAGTACTCGAGTACTACGTGGTCCCAAACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007793.2-160s1c1
Sequence:CCGGCCCAGCTTGAATCGAAAGAAACTCGAGTTTCTTTCGATTCAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007793.2-345s1c1
Sequence:CCGGACCAACAAAGAAAGGCACGATCTCGAGATCGTGCCTTTCTTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007793.2-266s1c1
Sequence:CCGGTGGAGATAAATGCGTGCACTTCTCGAGAAGTGCACGCATTTATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007793.2-237s1c1
Sequence:CCGGACCAACCTCTTCATCAAGGTTCTCGAGAACCTTGATGAAGAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000100
VALIDATED
CSTB MISSION shRNA Bacterial Glycerol Stock
cystatin B (stefin B)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000100.2-433s21c1
Sequence:CCGGCCAGAAGACTGACAAAGTCATCTCGAGATGACTTTGTCAGTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000100.2-340s21c1
Sequence:CCGGCAAGCCCTTGACCTTATCTAACTCGAGTTAGATAAGGTCAAGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000100.2-183s21c1
Sequence:CCGGCCCAGCTTGAAGAGAAAGAAACTCGAGTTTCTTTCTCTTCAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000100.2-365s21c1
Sequence:CCGGCAGACCAACAAAGCCAAGCATCTCGAGATGCTTGGCTTTGTTGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000100.2-365s1c1
Sequence:CCGGCAGACCAACAAAGCCAAGCATCTCGAGATGCTTGGCTTTGTTGGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000100.2-433s1c1
Sequence:CCGGCCAGAAGACTGACAAAGTCATCTCGAGATGACTTTGTCAGTCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000100.2-340s1c1
Sequence:CCGGCAAGCCCTTGACCTTATCTAACTCGAGTTAGATAAGGTCAAGGGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000100.2-216s1c1
Sequence:CCGGCTGTGTTTAAGGCCGTGTCATCTCGAGATGACACGGCCTTAAACACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000100.2-183s1c1
Sequence:CCGGCCCAGCTTGAAGAGAAAGAAACTCGAGTTTCTTTCTCTTCAAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000100
VALIDATED
CSTB MISSION shRNA shRNA Plasmid DNA
cystatin B (stefin B)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000100.2-433s21c1
Sequence:CCGGCCAGAAGACTGACAAAGTCATCTCGAGATGACTTTGTCAGTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000100.2-340s21c1
Sequence:CCGGCAAGCCCTTGACCTTATCTAACTCGAGTTAGATAAGGTCAAGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000100.2-183s21c1
Sequence:CCGGCCCAGCTTGAAGAGAAAGAAACTCGAGTTTCTTTCTCTTCAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000100.2-365s21c1
Sequence:CCGGCAGACCAACAAAGCCAAGCATCTCGAGATGCTTGGCTTTGTTGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000100.2-365s1c1
Sequence:CCGGCAGACCAACAAAGCCAAGCATCTCGAGATGCTTGGCTTTGTTGGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000100.2-433s1c1
Sequence:CCGGCCAGAAGACTGACAAAGTCATCTCGAGATGACTTTGTCAGTCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000100.2-340s1c1
Sequence:CCGGCAAGCCCTTGACCTTATCTAACTCGAGTTAGATAAGGTCAAGGGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000100.2-216s1c1
Sequence:CCGGCTGTGTTTAAGGCCGTGTCATCTCGAGATGACACGGCCTTAAACACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000100.2-183s1c1
Sequence:CCGGCCCAGCTTGAAGAGAAAGAAACTCGAGTTTCTTTCTCTTCAAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000100
VALIDATED
CSTB MISSION shRNA Lentiviral Transduction Particles
cystatin B (stefin B)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000100.2-433s21c1
Sequence:CCGGCCAGAAGACTGACAAAGTCATCTCGAGATGACTTTGTCAGTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000100.2-340s21c1
Sequence:CCGGCAAGCCCTTGACCTTATCTAACTCGAGTTAGATAAGGTCAAGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000100.2-183s21c1
Sequence:CCGGCCCAGCTTGAAGAGAAAGAAACTCGAGTTTCTTTCTCTTCAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000100.2-365s21c1
Sequence:CCGGCAGACCAACAAAGCCAAGCATCTCGAGATGCTTGGCTTTGTTGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000100.2-365s1c1
Sequence:CCGGCAGACCAACAAAGCCAAGCATCTCGAGATGCTTGGCTTTGTTGGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000100.2-433s1c1
Sequence:CCGGCCAGAAGACTGACAAAGTCATCTCGAGATGACTTTGTCAGTCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000100.2-340s1c1
Sequence:CCGGCAAGCCCTTGACCTTATCTAACTCGAGTTAGATAAGGTCAAGGGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000100.2-216s1c1
Sequence:CCGGCTGTGTTTAAGGCCGTGTCATCTCGAGATGACACGGCCTTAAACACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000100.2-183s1c1
Sequence:CCGGCCCAGCTTGAAGAGAAAGAAACTCGAGTTTCTTTCTCTTCAAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks