EMAIL THIS PAGE TO A FRIEND

CSTF1

cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa

80 Gene Product Result for
Synonyms: CstF-50 CstFp50
UniProtKB ID: Q05048, Q5QPD8
Gene ID:
Human(1477) Summary: This gene encodes one of three subunits which combine to form cleavage stimulation factor (CSTF). CSTF is involved in the polyadenylation and 3'end cleavage of pre-mRNAs. Similar to mammalian G protein beta subunits, this protein contains transducin-like repeats. Several transcript variants with different 5' UTR, but encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(67337) cleavage stimulation factor, 3' pre-RNA, subunit 1
Rat(311670) cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa
Zebrafish(324238) cleavage stimulation factor, 3' pre-RNA, subunit 1
domestic cat(101090931) cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa
dog(612933) cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa
cow(507051) cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa
chicken(419331) cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa
domestic guinea pig(100726361) cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa
naked mole-rat(101711727) cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa
sheep(101119326) cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001324 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001324 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001324 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024199 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024199 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024199 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033521 Rosetta Predictions human pricing
NM_001033522 Rosetta Predictions human pricing
NM_001324 Rosetta Predictions human pricing
NM_001013161 Rosetta Predictions rat pricing
NM_024199 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054642 predicted 878
2 SASI_Hs01_00054643 predicted 556
3 SASI_Hs01_00054644 predicted 1561
4 SASI_Hs01_00054645 predicted 908
5 SASI_Hs01_00054646 predicted 967
6 SASI_Hs01_00054647 predicted 702
7 SASI_Hs01_00054648 predicted 438
8 SASI_Hs01_00054649 predicted 850
9 SASI_Hs01_00054651 predicted 629
10 SASI_Hs02_00308037 predicted 389
11 SASI_Hs01_00054650 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157211 predicted 876
2 SASI_Hs01_00157212 predicted 550
3 SASI_Hs01_00157213 predicted 1558
4 SASI_Hs01_00157214 predicted 907
5 SASI_Hs01_00157215 predicted 969
6 SASI_Hs01_00157216 predicted 697
7 SASI_Hs01_00157217 predicted 427
8 SASI_Hs01_00157218 predicted 840
9 SASI_Hs01_00157220 predicted 634
10 SASI_Hs02_00308038 predicted 387
11 SASI_Hs01_00157219 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001324 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152623 predicted 912
2 SASI_Hs01_00152624 predicted 584
3 SASI_Hs01_00152625 predicted 1588
4 SASI_Hs01_00152626 predicted 935
5 SASI_Hs01_00152627 predicted 999
6 SASI_Hs01_00152628 predicted 729
7 SASI_Hs01_00152629 predicted 457
8 SASI_Hs01_00152630 predicted 879
9 SASI_Hs01_00152632 predicted 665
10 SASI_Hs02_00331626 predicted 417
11 SASI_Hs01_00152631 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013161 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042928 predicted 1048
2 SASI_Rn01_00042929 predicted 364
3 SASI_Rn01_00042930 predicted 404
4 SASI_Rn01_00042931 predicted 415
5 SASI_Rn01_00042932 predicted 585
6 SASI_Rn01_00042933 predicted 548
7 SASI_Rn01_00042934 predicted 294
8 SASI_Rn01_00042936 predicted 980
9 SASI_Rn02_00200899 predicted 371
10 SASI_Rn02_00200900 predicted 312
11 SASI_Rn01_00042927 predicted 691
12 SASI_Rn01_00042935 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024199 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036501 predicted 487
2 SASI_Mm01_00036502 predicted 299
3 SASI_Mm01_00036503 predicted 641
4 SASI_Mm01_00036504 predicted 570
5 SASI_Mm01_00036505 predicted 1000
6 SASI_Mm01_00036500 predicted 352
7 SASI_Mm01_00036508 predicted 457
8 SASI_Mm01_00036509 predicted 552
9 SASI_Mm02_00327542 predicted 540
10 SASI_Mm02_00327543 predicted 781
11 SASI_Mm01_00036506 predicted 705
12 SASI_Mm01_00036507 predicted 541
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001324
VALIDATED
CSTF1 MISSION shRNA Bacterial Glycerol Stock
cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001324.1-950s1c1
Sequence:CCGGCCTCAAGATCAACACACCGATCTCGAGATCGGTGTGTTGATCTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001324.1-1166s1c1
Sequence:CCGGGTAGCTAAACTTTGGGAAATACTCGAGTATTTCCCAAAGTTTAGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001324.1-566s1c1
Sequence:CCGGGATGCTTCGATAAAGATACTTCTCGAGAAGTATCTTTATCGAAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001324.1-967s1c1
Sequence:CCGGCGATGCTATATGTTCCGTTAACTCGAGTTAACGGAACATATAGCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001324.1-1593s1c1
Sequence:CCGGCACATTCTTCTTGGATTTGTACTCGAGTACAAATCCAAGAAGAATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001324.1-244s1c1
Sequence:CCGGGCTGCTATATGACGGCTACATCTCGAGATGTAGCCGTCATATAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_001324.2-1640s21c1
Sequence:CCGGCACATTCTTCTTGGATTTGTACTCGAGTACAAATCCAAGAAGAATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001324.2-940s21c1
Sequence:CCGGCATCCTACTCTTCGCCTTTATCTCGAGATAAAGGCGAAGAGTAGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001324.2-291s21c1
Sequence:CCGGGCTGCTATATGACGGCTACATCTCGAGATGTAGCCGTCATATAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001324.2-613s21c1
Sequence:CCGGGATGCTTCGATAAAGATACTTCTCGAGAAGTATCTTTATCGAAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001324.2-558s21c1
Sequence:CCGGATGCCGTGTAGCTACCTATAGCTCGAGCTATAGGTAGCTACACGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001324
VALIDATED
CSTF1 MISSION shRNA shRNA Plasmid DNA
cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001324.1-950s1c1
Sequence:CCGGCCTCAAGATCAACACACCGATCTCGAGATCGGTGTGTTGATCTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001324.1-1166s1c1
Sequence:CCGGGTAGCTAAACTTTGGGAAATACTCGAGTATTTCCCAAAGTTTAGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001324.1-566s1c1
Sequence:CCGGGATGCTTCGATAAAGATACTTCTCGAGAAGTATCTTTATCGAAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001324.1-967s1c1
Sequence:CCGGCGATGCTATATGTTCCGTTAACTCGAGTTAACGGAACATATAGCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001324.1-1593s1c1
Sequence:CCGGCACATTCTTCTTGGATTTGTACTCGAGTACAAATCCAAGAAGAATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001324.1-244s1c1
Sequence:CCGGGCTGCTATATGACGGCTACATCTCGAGATGTAGCCGTCATATAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_001324.2-1640s21c1
Sequence:CCGGCACATTCTTCTTGGATTTGTACTCGAGTACAAATCCAAGAAGAATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001324.2-940s21c1
Sequence:CCGGCATCCTACTCTTCGCCTTTATCTCGAGATAAAGGCGAAGAGTAGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001324.2-291s21c1
Sequence:CCGGGCTGCTATATGACGGCTACATCTCGAGATGTAGCCGTCATATAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001324.2-613s21c1
Sequence:CCGGGATGCTTCGATAAAGATACTTCTCGAGAAGTATCTTTATCGAAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001324.2-558s21c1
Sequence:CCGGATGCCGTGTAGCTACCTATAGCTCGAGCTATAGGTAGCTACACGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001324
VALIDATED
CSTF1 MISSION shRNA Lentiviral Transduction Particles
cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001324.1-950s1c1
Sequence:CCGGCCTCAAGATCAACACACCGATCTCGAGATCGGTGTGTTGATCTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001324.1-1166s1c1
Sequence:CCGGGTAGCTAAACTTTGGGAAATACTCGAGTATTTCCCAAAGTTTAGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001324.1-566s1c1
Sequence:CCGGGATGCTTCGATAAAGATACTTCTCGAGAAGTATCTTTATCGAAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001324.1-967s1c1
Sequence:CCGGCGATGCTATATGTTCCGTTAACTCGAGTTAACGGAACATATAGCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001324.1-1593s1c1
Sequence:CCGGCACATTCTTCTTGGATTTGTACTCGAGTACAAATCCAAGAAGAATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001324.1-244s1c1
Sequence:CCGGGCTGCTATATGACGGCTACATCTCGAGATGTAGCCGTCATATAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_001324.2-1640s21c1
Sequence:CCGGCACATTCTTCTTGGATTTGTACTCGAGTACAAATCCAAGAAGAATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001324.2-940s21c1
Sequence:CCGGCATCCTACTCTTCGCCTTTATCTCGAGATAAAGGCGAAGAGTAGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001324.2-291s21c1
Sequence:CCGGGCTGCTATATGACGGCTACATCTCGAGATGTAGCCGTCATATAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001324.2-613s21c1
Sequence:CCGGGATGCTTCGATAAAGATACTTCTCGAGAAGTATCTTTATCGAAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001324.2-558s21c1
Sequence:CCGGATGCCGTGTAGCTACCTATAGCTCGAGCTATAGGTAGCTACACGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024199
VALIDATED
CSTF1 MISSION shRNA Bacterial Glycerol Stock
cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024199.1-1471s1c1
Sequence:CCGGGCCTTGGATCTGTGTGTGGAACTCGAGTTCCACACACAGATCCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024199.1-1042s1c1
Sequence:CCGGGTAGCGAAACTCTGGGAGATTCTCGAGAATCTCCCAGAGTTTCGCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024199.1-132s1c1
Sequence:CCGGCGGTTACATTAGTATCGCCAACTCGAGTTGGCGATACTAATGTAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024199.1-854s1c1
Sequence:CCGGGCTCCGTTAACTATAATCCTACTCGAGTAGGATTATAGTTAACGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024199.1-1140s1c1
Sequence:CCGGCAACCACACTGAGGACTATATCTCGAGATATAGTCCTCAGTGTGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024199.2-854s21c1
Sequence:CCGGGCTCCGTTAACTATAATCCTACTCGAGTAGGATTATAGTTAACGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024199.2-1471s21c1
Sequence:CCGGGCCTTGGATCTGTGTGTGGAACTCGAGTTCCACACACAGATCCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024199.2-1140s21c1
Sequence:CCGGCAACCACACTGAGGACTATATCTCGAGATATAGTCCTCAGTGTGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024199.2-1042s21c1
Sequence:CCGGGTAGCGAAACTCTGGGAGATTCTCGAGAATCTCCCAGAGTTTCGCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024199
VALIDATED
CSTF1 MISSION shRNA shRNA Plasmid DNA
cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024199.1-1471s1c1
Sequence:CCGGGCCTTGGATCTGTGTGTGGAACTCGAGTTCCACACACAGATCCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024199.1-1042s1c1
Sequence:CCGGGTAGCGAAACTCTGGGAGATTCTCGAGAATCTCCCAGAGTTTCGCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024199.1-132s1c1
Sequence:CCGGCGGTTACATTAGTATCGCCAACTCGAGTTGGCGATACTAATGTAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024199.1-854s1c1
Sequence:CCGGGCTCCGTTAACTATAATCCTACTCGAGTAGGATTATAGTTAACGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024199.1-1140s1c1
Sequence:CCGGCAACCACACTGAGGACTATATCTCGAGATATAGTCCTCAGTGTGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024199.2-854s21c1
Sequence:CCGGGCTCCGTTAACTATAATCCTACTCGAGTAGGATTATAGTTAACGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024199.2-1471s21c1
Sequence:CCGGGCCTTGGATCTGTGTGTGGAACTCGAGTTCCACACACAGATCCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024199.2-1140s21c1
Sequence:CCGGCAACCACACTGAGGACTATATCTCGAGATATAGTCCTCAGTGTGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024199.2-1042s21c1
Sequence:CCGGGTAGCGAAACTCTGGGAGATTCTCGAGAATCTCCCAGAGTTTCGCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024199
VALIDATED
CSTF1 MISSION shRNA Lentiviral Transduction Particles
cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024199.1-1471s1c1
Sequence:CCGGGCCTTGGATCTGTGTGTGGAACTCGAGTTCCACACACAGATCCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024199.1-1042s1c1
Sequence:CCGGGTAGCGAAACTCTGGGAGATTCTCGAGAATCTCCCAGAGTTTCGCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024199.1-132s1c1
Sequence:CCGGCGGTTACATTAGTATCGCCAACTCGAGTTGGCGATACTAATGTAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024199.1-854s1c1
Sequence:CCGGGCTCCGTTAACTATAATCCTACTCGAGTAGGATTATAGTTAACGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024199.1-1140s1c1
Sequence:CCGGCAACCACACTGAGGACTATATCTCGAGATATAGTCCTCAGTGTGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024199.2-854s21c1
Sequence:CCGGGCTCCGTTAACTATAATCCTACTCGAGTAGGATTATAGTTAACGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024199.2-1471s21c1
Sequence:CCGGGCCTTGGATCTGTGTGTGGAACTCGAGTTCCACACACAGATCCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024199.2-1140s21c1
Sequence:CCGGCAACCACACTGAGGACTATATCTCGAGATATAGTCCTCAGTGTGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024199.2-1042s21c1
Sequence:CCGGGTAGCGAAACTCTGGGAGATTCTCGAGAATCTCCCAGAGTTTCGCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)