EMAIL THIS PAGE TO A FRIEND

CSTF2

cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa

50 Gene Product Result for
Synonyms: CstF-64
UniProtKB ID: P33240, Q5H951, Q6LA74, Q8N502
Gene ID:
Human(1478) Summary: This gene encodes a nuclear protein with an RRM (RNA recognition motif) domain. The protein is a member of the cleavage stimulation factor (CSTF) complex that is involved in the 3' end cleavage and polyadenylation of pre-mRNAs. Specifically, this protein binds GU-rich elements within the 3'-untranslated region of mRNAs. [provided by RefSeq, Jul 2008]
Mouse(108062) cleavage stimulation factor, 3' pre-RNA subunit 2
Rat(683927) cleavage stimulation factor, 3' pre-RNA subunit 2
sheep(101103214) cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa
Domestic Rabbit(100342333) cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa
naked mole-rat(101718350) cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa
domestic guinea pig(100713657) cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa
Zebrafish(386806) cleavage stimulation factor, 3' pre-RNA, subunit 2
cow(282588) cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa
Horse(100057347) cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa
domestic cat(101086122) cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa
dog(492015) cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa
chicken(422258) cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133196 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133196 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133196 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001325 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001325 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001325 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001325 Rosetta Predictions human pricing
NM_001131014 Rosetta Predictions rat pricing
NM_133196 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021564 predicted 1616
2 SASI_Hs01_00021565 predicted 222
3 SASI_Hs01_00021566 predicted 1622
4 SASI_Hs02_00331627 predicted 711
5 SASI_Hs01_00021568 predicted 282
6 SASI_Hs01_00021569 predicted 530
7 SASI_Hs01_00021570 predicted 1049
8 SASI_Hs01_00021571 predicted 1342
9 SASI_Hs02_00331628 predicted 236
10 SASI_Hs01_00021572 predicted 529
11 SASI_Hs01_00021567 predicted 386
12 SASI_Hs01_00021573 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001131014 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256189 predicted 700
2 SASI_Rn02_00256190 predicted 1769
3 SASI_Rn02_00256191 predicted 1065
4 SASI_Rn02_00256192 predicted 229
5 SASI_Rn02_00256193 predicted 1685
6 SASI_Rn02_00256194 predicted 1429
7 SASI_Rn02_00256195 predicted 338
8 SASI_Rn02_00256196 predicted 1634
9 SASI_Rn02_00256197 predicted 830
10 SASI_Rn02_00256198 predicted 1675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133196 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075763 predicted 278
2 SASI_Mm01_00075764 predicted 1790
3 SASI_Mm01_00075765 predicted 432
4 SASI_Mm01_00075767 predicted 704
5 SASI_Mm01_00075768 predicted 232
6 SASI_Mm01_00075769 predicted 340
7 SASI_Mm01_00075770 predicted 486
8 SASI_Mm01_00075771 predicted 495
9 SASI_Mm01_00075772 predicted 1286
10 SASI_Mm02_00338382 predicted 1442
11 SASI_Mm01_00075766 predicted 1705
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133196
VALIDATED
CSTF2 MISSION shRNA Bacterial Glycerol Stock
cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133196.5-341s21c1
Sequence:CCGGCCTGTCATAGAGTCACCTTATCTCGAGATAAGGTGACTCTATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133196.5-539s21c1
Sequence:CCGGGCACAGGTAGTGATGAGAATTCTCGAGAATTCTCATCACTACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133196.5-1775s21c1
Sequence:CCGGGCTGGCAACAAATCTGGAAATCTCGAGATTTCCAGATTTGTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133196.5-1699s21c1
Sequence:CCGGGCAAAGACAGAGTATCCTAATCTCGAGATTAGGATACTCTGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133196.3-1700s1c1
Sequence:CCGGGCAAAGACAGAGTATCCTAATCTCGAGATTAGGATACTCTGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133196.3-1776s1c1
Sequence:CCGGGCTGGCAACAAATCTGGAAATCTCGAGATTTCCAGATTTGTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133196.3-342s1c1
Sequence:CCGGCCTGTCATAGAGTCACCTTATCTCGAGATAAGGTGACTCTATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133196.3-1641s1c1
Sequence:CCGGGCTTTGATTATGCAGGTCCTTCTCGAGAAGGACCTGCATAATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133196.3-540s1c1
Sequence:CCGGGCACAGGTAGTGATGAGAATTCTCGAGAATTCTCATCACTACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133196
VALIDATED
CSTF2 MISSION shRNA shRNA Plasmid DNA
cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133196.5-341s21c1
Sequence:CCGGCCTGTCATAGAGTCACCTTATCTCGAGATAAGGTGACTCTATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133196.5-539s21c1
Sequence:CCGGGCACAGGTAGTGATGAGAATTCTCGAGAATTCTCATCACTACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133196.5-1775s21c1
Sequence:CCGGGCTGGCAACAAATCTGGAAATCTCGAGATTTCCAGATTTGTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133196.5-1699s21c1
Sequence:CCGGGCAAAGACAGAGTATCCTAATCTCGAGATTAGGATACTCTGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133196.3-1700s1c1
Sequence:CCGGGCAAAGACAGAGTATCCTAATCTCGAGATTAGGATACTCTGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133196.3-1776s1c1
Sequence:CCGGGCTGGCAACAAATCTGGAAATCTCGAGATTTCCAGATTTGTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133196.3-342s1c1
Sequence:CCGGCCTGTCATAGAGTCACCTTATCTCGAGATAAGGTGACTCTATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133196.3-1641s1c1
Sequence:CCGGGCTTTGATTATGCAGGTCCTTCTCGAGAAGGACCTGCATAATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133196.3-540s1c1
Sequence:CCGGGCACAGGTAGTGATGAGAATTCTCGAGAATTCTCATCACTACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133196
VALIDATED
CSTF2 MISSION shRNA Lentiviral Transduction Particles
cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133196.5-341s21c1
Sequence:CCGGCCTGTCATAGAGTCACCTTATCTCGAGATAAGGTGACTCTATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133196.5-539s21c1
Sequence:CCGGGCACAGGTAGTGATGAGAATTCTCGAGAATTCTCATCACTACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133196.5-1775s21c1
Sequence:CCGGGCTGGCAACAAATCTGGAAATCTCGAGATTTCCAGATTTGTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133196.5-1699s21c1
Sequence:CCGGGCAAAGACAGAGTATCCTAATCTCGAGATTAGGATACTCTGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133196.3-1700s1c1
Sequence:CCGGGCAAAGACAGAGTATCCTAATCTCGAGATTAGGATACTCTGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133196.3-1776s1c1
Sequence:CCGGGCTGGCAACAAATCTGGAAATCTCGAGATTTCCAGATTTGTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133196.3-342s1c1
Sequence:CCGGCCTGTCATAGAGTCACCTTATCTCGAGATAAGGTGACTCTATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133196.3-1641s1c1
Sequence:CCGGGCTTTGATTATGCAGGTCCTTCTCGAGAAGGACCTGCATAATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133196.3-540s1c1
Sequence:CCGGGCACAGGTAGTGATGAGAATTCTCGAGAATTCTCATCACTACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001325
VALIDATED
CSTF2 MISSION shRNA Bacterial Glycerol Stock
cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001325.2-597s21c1
Sequence:CCGGGAATTGTGGATCCGGAAATTGCTCGAGCAATTTCCGGATCCACAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001325.2-1504s21c1
Sequence:CCGGGCAGGGTCCCAGTCCAATTAACTCGAGTTAATTGGACTGGGACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001325.2-1590s21c1
Sequence:CCGGGAGCAAGTATACAGGGTGGAACTCGAGTTCCACCCTGTATACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001325.2-184s21c1
Sequence:CCGGTGTTAGTTTCAGATTGGTATACTCGAGTATACCAATCTGAAACTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001325.2-1809s21c1
Sequence:CCGGCCTGGCAAGAAATCTGGAAATCTCGAGATTTCCAGATTTCTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001325.1-601s1c1
Sequence:CCGGCCAGACAAATATCCCAACGCTCTCGAGAGCGTTGGGATATTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001325.1-1554s1c1
Sequence:CCGGGAGCAAGTATACAGGGTGGAACTCGAGTTCCACCCTGTATACTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001325.1-1696s1c1
Sequence:CCGGGCAAAGGCAGAGTATCCTGATCTCGAGATCAGGATACTCTGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001325.1-512s1c1
Sequence:CCGGCAGAACCCTCAACTGGCTTATCTCGAGATAAGCCAGTTGAGGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001325.1-1773s1c1
Sequence:CCGGCCTGGCAAGAAATCTGGAAATCTCGAGATTTCCAGATTTCTTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001325.1-347s1c1
Sequence:CCGGCCTGTCATTGAGTCACCTTATCTCGAGATAAGGTGACTCAATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001325.1-1637s1c1
Sequence:CCGGGCTTTGATTATGCAGGTTCTACTCGAGTAGAACCTGCATAATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_001325.1-1025s1c1
Sequence:CCGGCTTTCTGTAACTGGAGAGGTACTCGAGTACCTCTCCAGTTACAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001325
VALIDATED
CSTF2 MISSION shRNA shRNA Plasmid DNA
cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001325.2-597s21c1
Sequence:CCGGGAATTGTGGATCCGGAAATTGCTCGAGCAATTTCCGGATCCACAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001325.2-1504s21c1
Sequence:CCGGGCAGGGTCCCAGTCCAATTAACTCGAGTTAATTGGACTGGGACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001325.2-1590s21c1
Sequence:CCGGGAGCAAGTATACAGGGTGGAACTCGAGTTCCACCCTGTATACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001325.2-184s21c1
Sequence:CCGGTGTTAGTTTCAGATTGGTATACTCGAGTATACCAATCTGAAACTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001325.2-1809s21c1
Sequence:CCGGCCTGGCAAGAAATCTGGAAATCTCGAGATTTCCAGATTTCTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001325.1-601s1c1
Sequence:CCGGCCAGACAAATATCCCAACGCTCTCGAGAGCGTTGGGATATTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001325.1-1554s1c1
Sequence:CCGGGAGCAAGTATACAGGGTGGAACTCGAGTTCCACCCTGTATACTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001325.1-1696s1c1
Sequence:CCGGGCAAAGGCAGAGTATCCTGATCTCGAGATCAGGATACTCTGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001325.1-512s1c1
Sequence:CCGGCAGAACCCTCAACTGGCTTATCTCGAGATAAGCCAGTTGAGGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001325.1-1773s1c1
Sequence:CCGGCCTGGCAAGAAATCTGGAAATCTCGAGATTTCCAGATTTCTTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001325.1-347s1c1
Sequence:CCGGCCTGTCATTGAGTCACCTTATCTCGAGATAAGGTGACTCAATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001325.1-1637s1c1
Sequence:CCGGGCTTTGATTATGCAGGTTCTACTCGAGTAGAACCTGCATAATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_001325.1-1025s1c1
Sequence:CCGGCTTTCTGTAACTGGAGAGGTACTCGAGTACCTCTCCAGTTACAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001325
VALIDATED
CSTF2 MISSION shRNA Lentiviral Transduction Particles
cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001325.2-597s21c1
Sequence:CCGGGAATTGTGGATCCGGAAATTGCTCGAGCAATTTCCGGATCCACAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001325.2-1504s21c1
Sequence:CCGGGCAGGGTCCCAGTCCAATTAACTCGAGTTAATTGGACTGGGACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001325.2-1590s21c1
Sequence:CCGGGAGCAAGTATACAGGGTGGAACTCGAGTTCCACCCTGTATACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001325.2-184s21c1
Sequence:CCGGTGTTAGTTTCAGATTGGTATACTCGAGTATACCAATCTGAAACTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001325.2-1809s21c1
Sequence:CCGGCCTGGCAAGAAATCTGGAAATCTCGAGATTTCCAGATTTCTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001325.1-601s1c1
Sequence:CCGGCCAGACAAATATCCCAACGCTCTCGAGAGCGTTGGGATATTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001325.1-1554s1c1
Sequence:CCGGGAGCAAGTATACAGGGTGGAACTCGAGTTCCACCCTGTATACTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001325.1-1696s1c1
Sequence:CCGGGCAAAGGCAGAGTATCCTGATCTCGAGATCAGGATACTCTGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001325.1-512s1c1
Sequence:CCGGCAGAACCCTCAACTGGCTTATCTCGAGATAAGCCAGTTGAGGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001325.1-1773s1c1
Sequence:CCGGCCTGGCAAGAAATCTGGAAATCTCGAGATTTCCAGATTTCTTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001325.1-347s1c1
Sequence:CCGGCCTGTCATTGAGTCACCTTATCTCGAGATAAGGTGACTCAATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001325.1-1637s1c1
Sequence:CCGGGCTTTGATTATGCAGGTTCTACTCGAGTAGAACCTGCATAATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_001325.1-1025s1c1
Sequence:CCGGCTTTCTGTAACTGGAGAGGTACTCGAGTACCTCTCCAGTTACAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks