EMAIL THIS PAGE TO A FRIEND

CSTF2T

cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant

90 Gene Product Result for
Synonyms: CstF-64T
UniProtKB ID: Q9H0L4, B2RAR9, O75174, Q53HK6, Q7LGE8, Q8N6T1
Gene ID:
Mouse(83410) cleavage stimulation factor, 3' pre-RNA subunit 2, tau
Rat(309338) cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant
domestic cat(101090389) cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant
cow(783569) cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant
domestic guinea pig(100735116) cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant
naked mole-rat(101707151) cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant
sheep(101117378) cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant
Domestic Rabbit(100357418) cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031249 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031249 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031249 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015235 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015235 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015235 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015235 Rosetta Predictions human pricing
NM_001107586 Rosetta Predictions rat pricing
NM_031249 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080917 predicted 1318
2 SASI_Hs01_00080918 predicted 710
3 SASI_Hs01_00080919 predicted 953
4 SASI_Hs01_00080920 predicted 369
5 SASI_Hs01_00080921 predicted 363
6 SASI_Hs01_00080922 predicted 1316
7 SASI_Hs01_00080923 predicted 1302
8 SASI_Hs01_00080924 predicted 714
9 SASI_Hs01_00080925 predicted 513
10 SASI_Hs02_00347365 predicted 1277
11 SASI_Hs01_00080926 predicted 1283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107586 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230295 predicted 268
2 SASI_Rn02_00230296 predicted 1290
3 SASI_Rn02_00230297 predicted 1373
4 SASI_Rn02_00230298 predicted 291
5 SASI_Rn02_00230299 predicted 473
6 SASI_Rn02_00230300 predicted 287
7 SASI_Rn02_00230301 predicted 305
8 SASI_Rn02_00230302 predicted 219
9 SASI_Rn02_00230303 predicted 1299
10 SASI_Rn02_00230304 predicted 1248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031249 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064808 predicted 2138
2 SASI_Mm02_00337072 predicted 444
3 SASI_Mm01_00064811 predicted 444
4 SASI_Mm01_00064812 predicted 1441
5 SASI_Mm01_00064813 predicted 1417
6 SASI_Mm02_00337073 predicted 2147
7 SASI_Mm01_00064814 predicted 1218
8 SASI_Mm01_00064816 predicted 2207
9 SASI_Mm01_00064817 predicted 2207
10 SASI_Mm02_00337074 predicted 487
11 SASI_Mm01_00064809 predicted 2269
12 SASI_Mm01_00064810 predicted 2106
13 SASI_Mm01_00064815 predicted 2066
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031249
VALIDATED
CSTF2T MISSION shRNA Bacterial Glycerol Stock
cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194628    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031249.1-3168s1c1
Sequence:CCGGGCACCTAGACACCATGTCATACTCGAGTATGACATGGTGTCTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031249.1-781s1c1
Sequence:CCGGCGTCATGTTGAACCAACAGAACTCGAGTTCTGTTGGTTCAACATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031249.1-367s1c1
Sequence:CCGGCAAGGAGGAGTTAAAGAGCTTCTCGAGAAGCTCTTTAACTCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031249.1-658s1c1
Sequence:CCGGGATACATGTCACACCACTGATCTCGAGATCAGTGGTGTGACATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031249.1-776s1c1
Sequence:CCGGCCTAACGTCATGTTGAACCAACTCGAGTTGGTTCAACATGACGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_031249.1-3015s1c1
Sequence:CCGGGCTCTGCTCAACTTAGTATTTCTCGAGAAATACTAAGTTGAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_031249.1-782s1c1
Sequence:CCGGGTCATGTTGAACCAACAGAATCTCGAGATTCTGTTGGTTCAACATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_031249.1-1905s1c1
Sequence:CCGGCCGAACAAAGGCAGAGCATTTCTCGAGAAATGCTCTGCCTTTGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031249.2-2328s21c1
Sequence:CCGGCCTGTTCACTTTGTCACTGTTCTCGAGAACAGTGACAAAGTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031249.2-1663s21c1
Sequence:CCGGCAGGGTCCTGGCCCTATTAATCTCGAGATTAATAGGGCCAGGACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031249.2-937s21c1
Sequence:CCGGGTCATGTTGAACCAACAGAATCTCGAGATTCTGTTGGTTCAACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031249.2-452s21c1
Sequence:CCGGACCTCAATGGGCGAGAGTTTACTCGAGTAAACTCTCGCCCATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031249.2-3170s21c1
Sequence:CCGGGCTCTGCTCAACTTAGTATTTCTCGAGAAATACTAAGTTGAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031249
VALIDATED
CSTF2T MISSION shRNA shRNA Plasmid DNA
cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194628    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031249.1-3168s1c1
Sequence:CCGGGCACCTAGACACCATGTCATACTCGAGTATGACATGGTGTCTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031249.1-781s1c1
Sequence:CCGGCGTCATGTTGAACCAACAGAACTCGAGTTCTGTTGGTTCAACATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031249.1-367s1c1
Sequence:CCGGCAAGGAGGAGTTAAAGAGCTTCTCGAGAAGCTCTTTAACTCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031249.1-658s1c1
Sequence:CCGGGATACATGTCACACCACTGATCTCGAGATCAGTGGTGTGACATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031249.1-776s1c1
Sequence:CCGGCCTAACGTCATGTTGAACCAACTCGAGTTGGTTCAACATGACGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_031249.1-3015s1c1
Sequence:CCGGGCTCTGCTCAACTTAGTATTTCTCGAGAAATACTAAGTTGAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_031249.1-782s1c1
Sequence:CCGGGTCATGTTGAACCAACAGAATCTCGAGATTCTGTTGGTTCAACATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_031249.1-1905s1c1
Sequence:CCGGCCGAACAAAGGCAGAGCATTTCTCGAGAAATGCTCTGCCTTTGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031249.2-2328s21c1
Sequence:CCGGCCTGTTCACTTTGTCACTGTTCTCGAGAACAGTGACAAAGTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031249.2-1663s21c1
Sequence:CCGGCAGGGTCCTGGCCCTATTAATCTCGAGATTAATAGGGCCAGGACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031249.2-937s21c1
Sequence:CCGGGTCATGTTGAACCAACAGAATCTCGAGATTCTGTTGGTTCAACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031249.2-452s21c1
Sequence:CCGGACCTCAATGGGCGAGAGTTTACTCGAGTAAACTCTCGCCCATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031249.2-3170s21c1
Sequence:CCGGGCTCTGCTCAACTTAGTATTTCTCGAGAAATACTAAGTTGAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031249
VALIDATED
CSTF2T MISSION shRNA Lentiviral Transduction Particles
cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194628    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031249.1-3168s1c1
Sequence:CCGGGCACCTAGACACCATGTCATACTCGAGTATGACATGGTGTCTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031249.1-781s1c1
Sequence:CCGGCGTCATGTTGAACCAACAGAACTCGAGTTCTGTTGGTTCAACATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031249.1-367s1c1
Sequence:CCGGCAAGGAGGAGTTAAAGAGCTTCTCGAGAAGCTCTTTAACTCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031249.1-658s1c1
Sequence:CCGGGATACATGTCACACCACTGATCTCGAGATCAGTGGTGTGACATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031249.1-776s1c1
Sequence:CCGGCCTAACGTCATGTTGAACCAACTCGAGTTGGTTCAACATGACGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_031249.1-3015s1c1
Sequence:CCGGGCTCTGCTCAACTTAGTATTTCTCGAGAAATACTAAGTTGAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_031249.1-782s1c1
Sequence:CCGGGTCATGTTGAACCAACAGAATCTCGAGATTCTGTTGGTTCAACATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_031249.1-1905s1c1
Sequence:CCGGCCGAACAAAGGCAGAGCATTTCTCGAGAAATGCTCTGCCTTTGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031249.2-2328s21c1
Sequence:CCGGCCTGTTCACTTTGTCACTGTTCTCGAGAACAGTGACAAAGTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031249.2-1663s21c1
Sequence:CCGGCAGGGTCCTGGCCCTATTAATCTCGAGATTAATAGGGCCAGGACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031249.2-937s21c1
Sequence:CCGGGTCATGTTGAACCAACAGAATCTCGAGATTCTGTTGGTTCAACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031249.2-452s21c1
Sequence:CCGGACCTCAATGGGCGAGAGTTTACTCGAGTAAACTCTCGCCCATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031249.2-3170s21c1
Sequence:CCGGGCTCTGCTCAACTTAGTATTTCTCGAGAAATACTAAGTTGAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015235
VALIDATED
CSTF2T MISSION shRNA Bacterial Glycerol Stock
cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_015235.2-2094s1c1
Sequence:CCGGGCGTCTGTTCACTTTAAGTTACTCGAGTAACTTAAAGTGAACAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015235.2-3074s1c1
Sequence:CCGGGCTCTGATGAAACCCAATAATCTCGAGATTATTGGGTTTCATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015235.2-466s1c1
Sequence:CCGGGTTTGAGCTGATGAAGCAGATCTCGAGATCTGCTTCATCAGCTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015235.2-1029s1c1
Sequence:CCGGGACTGTTAGGAGATGCTCCAACTCGAGTTGGAGCATCTCCTAACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015235.2-1837s1c1
Sequence:CCGGGCAAAGGCAGAGTATCCTGATCTCGAGATCAGGATACTCTGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015235.2-75s1c1
Sequence:CCGGCAATGGATCGATCACTGCGTTCTCGAGAACGCAGTGATCGATCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015235.2-623s1c1
Sequence:CCGGCGGAAGATACATGTCACACCACTCGAGTGGTGTGACATGTATCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_015235.2-1638s1c1
Sequence:CCGGCAGGCATACAAGGAGTCAGTACTCGAGTACTGACTCCTTGTATGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_015235.2-1322s1c1
Sequence:CCGGGAGGTCTTAGAGACACGTGTACTCGAGTACACGTGTCTCTAAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_015235.2-1838s1c1
Sequence:CCGGCAAAGGCAGAGTATCCTGATTCTCGAGAATCAGGATACTCTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141996    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015235.2-3446s1c1
Sequence:CCGGGCCTGAATACTCACTTGACTTCTCGAGAAGTCAAGTGAGTATTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015235.2-1778s1c1
Sequence:CCGGGCTTTGATCATGCAGGTTCTTCTCGAGAAGAACCTGCATGATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015235.2-3496s21c1
Sequence:CCGGCAGCCATTTAGTCCTAATATACTCGAGTATATTAGGACTAAATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015235.2-1640s21c1
Sequence:CCGGGGCATACAAGGAGTCAGTATACTCGAGTATACTGACTCCTTGTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015235.2-1472s21c1
Sequence:CCGGCAGGGTCCTGGTCCCATTAATCTCGAGATTAATGGGACCAGGACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015235.2-1324s21c1
Sequence:CCGGGGTCTTAGAGACACGTGTAATCTCGAGATTACACGTGTCTCTAAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015235.2-1203s21c1
Sequence:CCGGGAGATCCCAGACTGCTAATTGCTCGAGCAATTAGCAGTCTGGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015235
VALIDATED
CSTF2T MISSION shRNA shRNA Plasmid DNA
cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_015235.2-2094s1c1
Sequence:CCGGGCGTCTGTTCACTTTAAGTTACTCGAGTAACTTAAAGTGAACAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015235.2-3074s1c1
Sequence:CCGGGCTCTGATGAAACCCAATAATCTCGAGATTATTGGGTTTCATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015235.2-466s1c1
Sequence:CCGGGTTTGAGCTGATGAAGCAGATCTCGAGATCTGCTTCATCAGCTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015235.2-1029s1c1
Sequence:CCGGGACTGTTAGGAGATGCTCCAACTCGAGTTGGAGCATCTCCTAACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015235.2-1837s1c1
Sequence:CCGGGCAAAGGCAGAGTATCCTGATCTCGAGATCAGGATACTCTGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015235.2-75s1c1
Sequence:CCGGCAATGGATCGATCACTGCGTTCTCGAGAACGCAGTGATCGATCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015235.2-623s1c1
Sequence:CCGGCGGAAGATACATGTCACACCACTCGAGTGGTGTGACATGTATCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_015235.2-1638s1c1
Sequence:CCGGCAGGCATACAAGGAGTCAGTACTCGAGTACTGACTCCTTGTATGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_015235.2-1322s1c1
Sequence:CCGGGAGGTCTTAGAGACACGTGTACTCGAGTACACGTGTCTCTAAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_015235.2-1838s1c1
Sequence:CCGGCAAAGGCAGAGTATCCTGATTCTCGAGAATCAGGATACTCTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141996    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015235.2-3446s1c1
Sequence:CCGGGCCTGAATACTCACTTGACTTCTCGAGAAGTCAAGTGAGTATTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015235.2-1778s1c1
Sequence:CCGGGCTTTGATCATGCAGGTTCTTCTCGAGAAGAACCTGCATGATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015235.2-3496s21c1
Sequence:CCGGCAGCCATTTAGTCCTAATATACTCGAGTATATTAGGACTAAATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015235.2-1640s21c1
Sequence:CCGGGGCATACAAGGAGTCAGTATACTCGAGTATACTGACTCCTTGTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015235.2-1472s21c1
Sequence:CCGGCAGGGTCCTGGTCCCATTAATCTCGAGATTAATGGGACCAGGACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015235.2-1324s21c1
Sequence:CCGGGGTCTTAGAGACACGTGTAATCTCGAGATTACACGTGTCTCTAAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015235.2-1203s21c1
Sequence:CCGGGAGATCCCAGACTGCTAATTGCTCGAGCAATTAGCAGTCTGGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015235
VALIDATED
CSTF2T MISSION shRNA Lentiviral Transduction Particles
cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_015235.2-2094s1c1
Sequence:CCGGGCGTCTGTTCACTTTAAGTTACTCGAGTAACTTAAAGTGAACAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015235.2-3074s1c1
Sequence:CCGGGCTCTGATGAAACCCAATAATCTCGAGATTATTGGGTTTCATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015235.2-466s1c1
Sequence:CCGGGTTTGAGCTGATGAAGCAGATCTCGAGATCTGCTTCATCAGCTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015235.2-1029s1c1
Sequence:CCGGGACTGTTAGGAGATGCTCCAACTCGAGTTGGAGCATCTCCTAACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015235.2-1837s1c1
Sequence:CCGGGCAAAGGCAGAGTATCCTGATCTCGAGATCAGGATACTCTGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015235.2-75s1c1
Sequence:CCGGCAATGGATCGATCACTGCGTTCTCGAGAACGCAGTGATCGATCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015235.2-623s1c1
Sequence:CCGGCGGAAGATACATGTCACACCACTCGAGTGGTGTGACATGTATCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_015235.2-1638s1c1
Sequence:CCGGCAGGCATACAAGGAGTCAGTACTCGAGTACTGACTCCTTGTATGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_015235.2-1322s1c1
Sequence:CCGGGAGGTCTTAGAGACACGTGTACTCGAGTACACGTGTCTCTAAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_015235.2-1838s1c1
Sequence:CCGGCAAAGGCAGAGTATCCTGATTCTCGAGAATCAGGATACTCTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141996    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015235.2-3446s1c1
Sequence:CCGGGCCTGAATACTCACTTGACTTCTCGAGAAGTCAAGTGAGTATTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015235.2-1778s1c1
Sequence:CCGGGCTTTGATCATGCAGGTTCTTCTCGAGAAGAACCTGCATGATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015235.2-3496s21c1
Sequence:CCGGCAGCCATTTAGTCCTAATATACTCGAGTATATTAGGACTAAATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015235.2-1640s21c1
Sequence:CCGGGGCATACAAGGAGTCAGTATACTCGAGTATACTGACTCCTTGTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015235.2-1472s21c1
Sequence:CCGGCAGGGTCCTGGTCCCATTAATCTCGAGATTAATGGGACCAGGACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015235.2-1324s21c1
Sequence:CCGGGGTCTTAGAGACACGTGTAATCTCGAGATTACACGTGTCTCTAAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015235.2-1203s21c1
Sequence:CCGGGAGATCCCAGACTGCTAATTGCTCGAGCAATTAGCAGTCTGGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks