EMAIL THIS PAGE TO A FRIEND

CSTF3

cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa

184 Gene Product Result for
Synonyms: CSTF-77
Gene ID:
Human(1479) Summary: The protein encoded by this gene is one of three (including CSTF1 and CSTF2) cleavage stimulation factors that combine to form the cleavage stimulation factor complex (CSTF). This complex is involved in the polyadenylation and 3' end cleavage of pre-mRNAs. The encoded protein functions as a homodimer and interacts directly with both CSTF1 and CSTF2 in the CSTF complex. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(228410) cleavage stimulation factor, 3' pre-RNA, subunit 3
Rat(362178) cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa
sheep(101123147) cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa
Domestic Rabbit(100339047) cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa
naked mole-rat(101713352) cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa
domestic guinea pig(100734217) cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa
Zebrafish(406326) cleavage stimulation factor, 3' pre-RNA, subunit 3
chicken(421595) cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa
cow(508491) cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa
domestic cat(101089960) cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa
Horse(100060162) cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa
dog(475948) cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145529 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145529 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145529 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001326 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001326 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001326 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU070921 MISSION® esiRNA esiRNA targeting mouse Cstf3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033505 Rosetta Predictions human pricing
NM_001033506 Rosetta Predictions human pricing
NM_001326 Rosetta Predictions human pricing
NM_001077672 Rosetta Predictions rat pricing
NM_001037326 Rosetta Predictions mouse pricing
NM_145529 Rosetta Predictions mouse pricing
NM_177253 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071203 predicted 310
2 SASI_Hs01_00071204 predicted 281
3 SASI_Hs01_00071205 predicted 277
4 SASI_Hs01_00071206 predicted 255
5 SASI_Hs02_00308026 predicted 375
6 SASI_Hs01_00071207 predicted 373
7 SASI_Hs01_00071208 predicted 249
8 SASI_Hs01_00071209 predicted 242
9 SASI_Hs01_00071210 predicted 266
10 SASI_Hs01_00071211 predicted 255
11 SASI_Hs01_00071212 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031928 predicted 433
2 SASI_Hs01_00031929 predicted 578
3 SASI_Hs02_00308027 predicted 591
4 SASI_Hs01_00031930 predicted 257
5 SASI_Hs02_00308028 predicted 499
6 SASI_Hs01_00031931 predicted 598
7 SASI_Hs01_00031932 predicted 247
8 SASI_Hs02_00308029 predicted 194
9 SASI_Hs01_00031933 predicted 293
10 SASI_Hs01_00031934 predicted 261
11 SASI_Hs01_00031935 predicted 425
12 SASI_Hs01_00031936 predicted 295
13 SASI_Hs01_00031937 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091567 predicted 719
2 SASI_Hs01_00091568 predicted 278
3 SASI_Hs02_00331629 predicted 1149
4 SASI_Hs02_00331630 predicted 1507
5 SASI_Hs02_00331631 predicted 1491
6 SASI_Hs01_00091570 predicted 780
7 SASI_Hs01_00091571 predicted 1947
8 SASI_Hs02_00331632 predicted 1056
9 SASI_Hs01_00091572 predicted 1543
10 SASI_Hs01_00091574 predicted 579
11 SASI_Hs01_00091565 predicted 292
12 SASI_Hs01_00091566 predicted 2367
13 SASI_Hs01_00091569 predicted 464
14 SASI_Hs01_00091573 predicted 2392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077672 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207842 predicted 690
2 SASI_Rn02_00207843 predicted 1025
3 SASI_Rn02_00207844 predicted 1459
4 SASI_Rn02_00207845 predicted 1199
5 SASI_Rn02_00207846 predicted 1724
6 SASI_Rn02_00207847 predicted 618
7 SASI_Rn02_00207848 predicted 246
8 SASI_Rn02_00207849 predicted 546
9 SASI_Rn02_00207850 predicted 1572
10 SASI_Rn02_00207851 predicted 1442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037326 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180175 predicted 367
2 SASI_Mm01_00180176 predicted 343
3 SASI_Mm01_00180177 predicted 499
4 SASI_Mm01_00180178 predicted 350
5 SASI_Mm02_00289305 predicted 276
6 SASI_Mm01_00180179 predicted 517
7 SASI_Mm01_00180180 predicted 461
8 SASI_Mm02_00289306 predicted 274
9 SASI_Mm02_00289307 predicted 431
10 SASI_Mm02_00289308 predicted 273
11 SASI_Mm01_00180181 predicted 212
12 SASI_Mm01_00180182 predicted 235
13 SASI_Mm01_00180183 predicted 380
14 SASI_Mm01_00180184 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145529 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119863 predicted 1959
2 SASI_Mm01_00119864 predicted 747
3 SASI_Mm01_00119865 predicted 1081
4 SASI_Mm02_00341010 predicted 798
5 SASI_Mm01_00119866 predicted 1632
6 SASI_Mm02_00341011 predicted 671
7 SASI_Mm01_00119867 predicted 1135
8 SASI_Mm01_00119868 predicted 565
9 SASI_Mm01_00119869 predicted 299
10 SASI_Mm01_00119870 predicted 617
11 SASI_Mm01_00119871 predicted 1646
12 SASI_Mm01_00119872 predicted 1519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177253 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068183 predicted 455
2 SASI_Mm01_00068184 predicted 301
3 SASI_Mm01_00068185 predicted 482
4 SASI_Mm01_00068186 predicted 577
5 SASI_Mm01_00068188 predicted 404
6 SASI_Mm01_00068189 predicted 316
7 SASI_Mm02_00347288 predicted 511
8 SASI_Mm01_00068191 predicted 821
9 SASI_Mm02_00347289 predicted 805
10 SASI_Mm02_00347290 predicted 294
11 SASI_Mm01_00068187 predicted 232
12 SASI_Mm01_00068190 predicted 295
13 SASI_Mm01_00068192 predicted 443
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145529
VALIDATED
CSTF3 MISSION shRNA Bacterial Glycerol Stock
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145529.3-1141s21c1
Sequence:CCGGGCCAAGTTATTTAGTGACGAACTCGAGTTCGTCACTAAATAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145529.3-2543s21c1
Sequence:CCGGCCTATCCTCTAAGCAAGATTACTCGAGTAATCTTGCTTAGAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145529.3-2338s21c1
Sequence:CCGGATACGATGAGTCGGCTTAAACCTCGAGGTTTAAGCCGACTCATCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145529.3-514s21c1
Sequence:CCGGGTCAGAGAAACCAAGGGTAAACTCGAGTTTACCCTTGGTTTCTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145529.3-1942s21c1
Sequence:CCGGCCAGACACTCAGCAGATGATTCTCGAGAATCATCTGCTGAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120942    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145529.1-2504s1c1
Sequence:CCGGCCTATCCTCTAAGCAAGATTACTCGAGTAATCTTGCTTAGAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145529.1-475s1c1
Sequence:CCGGGTCAGAGAAACCAAGGGTAAACTCGAGTTTACCCTTGGTTTCTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145529.1-1102s1c1
Sequence:CCGGGCCAAGTTATTTAGTGACGAACTCGAGTTCGTCACTAAATAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145529.1-1519s1c1
Sequence:CCGGCACCTCAATGAGGACAATAATCTCGAGATTATTGTCCTCATTGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145529.1-1903s1c1
Sequence:CCGGCCAGACACTCAGCAGATGATTCTCGAGAATCATCTGCTGAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145529
VALIDATED
CSTF3 MISSION shRNA shRNA Plasmid DNA
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145529.3-1141s21c1
Sequence:CCGGGCCAAGTTATTTAGTGACGAACTCGAGTTCGTCACTAAATAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145529.3-2543s21c1
Sequence:CCGGCCTATCCTCTAAGCAAGATTACTCGAGTAATCTTGCTTAGAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145529.3-2338s21c1
Sequence:CCGGATACGATGAGTCGGCTTAAACCTCGAGGTTTAAGCCGACTCATCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145529.3-514s21c1
Sequence:CCGGGTCAGAGAAACCAAGGGTAAACTCGAGTTTACCCTTGGTTTCTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145529.3-1942s21c1
Sequence:CCGGCCAGACACTCAGCAGATGATTCTCGAGAATCATCTGCTGAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120942    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145529.1-2504s1c1
Sequence:CCGGCCTATCCTCTAAGCAAGATTACTCGAGTAATCTTGCTTAGAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145529.1-475s1c1
Sequence:CCGGGTCAGAGAAACCAAGGGTAAACTCGAGTTTACCCTTGGTTTCTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145529.1-1102s1c1
Sequence:CCGGGCCAAGTTATTTAGTGACGAACTCGAGTTCGTCACTAAATAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145529.1-1519s1c1
Sequence:CCGGCACCTCAATGAGGACAATAATCTCGAGATTATTGTCCTCATTGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145529.1-1903s1c1
Sequence:CCGGCCAGACACTCAGCAGATGATTCTCGAGAATCATCTGCTGAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145529
VALIDATED
CSTF3 MISSION shRNA Lentiviral Transduction Particles
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145529.3-1141s21c1
Sequence:CCGGGCCAAGTTATTTAGTGACGAACTCGAGTTCGTCACTAAATAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145529.3-2543s21c1
Sequence:CCGGCCTATCCTCTAAGCAAGATTACTCGAGTAATCTTGCTTAGAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145529.3-2338s21c1
Sequence:CCGGATACGATGAGTCGGCTTAAACCTCGAGGTTTAAGCCGACTCATCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145529.3-514s21c1
Sequence:CCGGGTCAGAGAAACCAAGGGTAAACTCGAGTTTACCCTTGGTTTCTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145529.3-1942s21c1
Sequence:CCGGCCAGACACTCAGCAGATGATTCTCGAGAATCATCTGCTGAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120942    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145529.1-2504s1c1
Sequence:CCGGCCTATCCTCTAAGCAAGATTACTCGAGTAATCTTGCTTAGAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145529.1-475s1c1
Sequence:CCGGGTCAGAGAAACCAAGGGTAAACTCGAGTTTACCCTTGGTTTCTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145529.1-1102s1c1
Sequence:CCGGGCCAAGTTATTTAGTGACGAACTCGAGTTCGTCACTAAATAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145529.1-1519s1c1
Sequence:CCGGCACCTCAATGAGGACAATAATCTCGAGATTATTGTCCTCATTGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145529.1-1903s1c1
Sequence:CCGGCCAGACACTCAGCAGATGATTCTCGAGAATCATCTGCTGAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001326
VALIDATED
CSTF3 MISSION shRNA Bacterial Glycerol Stock
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001326.2-1128s21c1
Sequence:CCGGGTGATGAAGCTGCTAATATATCTCGAGATATATTAGCAGCTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001326.2-1499s21c1
Sequence:CCGGGAGTATGTCCTGGCCTATATTCTCGAGAATATAGGCCAGGACATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001326.2-2095s21c1
Sequence:CCGGCCGAAGATGCAAGATACCAAACTCGAGTTTGGTATCTTGCATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001326.2-2364s21c1
Sequence:CCGGTTGCCTCAAGTGGTATGTTTACTCGAGTAAACATACCACTTGAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001326.2-1820s21c1
Sequence:CCGGGCTAAGCTAGCAGCTATAATTCTCGAGAATTATAGCTGCTAGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001326.1-2570s1c1
Sequence:CCGGCGCTTGAAGATTTGTGAGTTTCTCGAGAAACTCACAAATCTTCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001326.1-1587s1c1
Sequence:CCGGGCCCGATTTCTAGCATTTGAACTCGAGTTCAAATGCTAGAAATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001326.1-1024s1c1
Sequence:CCGGCCCAGTATCTTGAGCAGTCAACTCGAGTTGACTGCTCAAGATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001326.1-2060s1c1
Sequence:CCGGCCGAAGATGCAAGATACCAAACTCGAGTTTGGTATCTTGCATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001326.1-547s1c1
Sequence:CCGGCCTATCAGATTTGGGTGGATTCTCGAGAATCCACCCAAATCTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001326
VALIDATED
CSTF3 MISSION shRNA shRNA Plasmid DNA
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001326.2-1128s21c1
Sequence:CCGGGTGATGAAGCTGCTAATATATCTCGAGATATATTAGCAGCTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001326.2-1499s21c1
Sequence:CCGGGAGTATGTCCTGGCCTATATTCTCGAGAATATAGGCCAGGACATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001326.2-2095s21c1
Sequence:CCGGCCGAAGATGCAAGATACCAAACTCGAGTTTGGTATCTTGCATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001326.2-2364s21c1
Sequence:CCGGTTGCCTCAAGTGGTATGTTTACTCGAGTAAACATACCACTTGAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001326.2-1820s21c1
Sequence:CCGGGCTAAGCTAGCAGCTATAATTCTCGAGAATTATAGCTGCTAGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001326.1-2570s1c1
Sequence:CCGGCGCTTGAAGATTTGTGAGTTTCTCGAGAAACTCACAAATCTTCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001326.1-1587s1c1
Sequence:CCGGGCCCGATTTCTAGCATTTGAACTCGAGTTCAAATGCTAGAAATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001326.1-1024s1c1
Sequence:CCGGCCCAGTATCTTGAGCAGTCAACTCGAGTTGACTGCTCAAGATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001326.1-2060s1c1
Sequence:CCGGCCGAAGATGCAAGATACCAAACTCGAGTTTGGTATCTTGCATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001326.1-547s1c1
Sequence:CCGGCCTATCAGATTTGGGTGGATTCTCGAGAATCCACCCAAATCTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001326
VALIDATED
CSTF3 MISSION shRNA Lentiviral Transduction Particles
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001326.2-1128s21c1
Sequence:CCGGGTGATGAAGCTGCTAATATATCTCGAGATATATTAGCAGCTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001326.2-1499s21c1
Sequence:CCGGGAGTATGTCCTGGCCTATATTCTCGAGAATATAGGCCAGGACATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001326.2-2095s21c1
Sequence:CCGGCCGAAGATGCAAGATACCAAACTCGAGTTTGGTATCTTGCATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001326.2-2364s21c1
Sequence:CCGGTTGCCTCAAGTGGTATGTTTACTCGAGTAAACATACCACTTGAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001326.2-1820s21c1
Sequence:CCGGGCTAAGCTAGCAGCTATAATTCTCGAGAATTATAGCTGCTAGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001326.1-2570s1c1
Sequence:CCGGCGCTTGAAGATTTGTGAGTTTCTCGAGAAACTCACAAATCTTCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001326.1-1587s1c1
Sequence:CCGGGCCCGATTTCTAGCATTTGAACTCGAGTTCAAATGCTAGAAATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001326.1-1024s1c1
Sequence:CCGGCCCAGTATCTTGAGCAGTCAACTCGAGTTGACTGCTCAAGATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001326.1-2060s1c1
Sequence:CCGGCCGAAGATGCAAGATACCAAACTCGAGTTTGGTATCTTGCATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001326.1-547s1c1
Sequence:CCGGCCTATCAGATTTGGGTGGATTCTCGAGAATCCACCCAAATCTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks