EMAIL THIS PAGE TO A FRIEND

CSTL1

cystatin-like 1

49 Gene Product Result for
Synonyms: CTES1 RCET11 dJ322G13.4
UniProtKB ID: Q9H114, Q17RA8, Q64FF7
Gene ID:
Human(128817) Summary: The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located at the telomeric end of the cystatin locus and encodes a type 2 cystatin-like protein. The specific function of this protein has not been determined. [provided by RefSeq, Jul 2008]
Mouse(228756) cystatin-like 1
Rat(296220) cystatin-like 1
cow(523331) cystatin-like 1
domestic cat(101087311) cystatin-like 1
dog(606837) cystatin-like 1
naked mole-rat(101703682) cystatin-like 1
sheep(101104001) cystatin-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500383 Anti-CSTL1 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence pricing
SAB4300919 Anti-CSTL1 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138283 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138283 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138283 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177655 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177655 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177655 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138283 Rosetta Predictions human pricing
NM_001106522 Rosetta Predictions rat pricing
NM_001004764 Rosetta Predictions mouse pricing
NM_177655 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363357 predicted 460
2 SASI_Hs01_00063606 predicted 409
3 SASI_Hs01_00063607 predicted 432
4 SASI_Hs01_00063608 predicted 403
5 SASI_Hs01_00063609 predicted 413
6 SASI_Hs01_00063610 predicted 347
7 SASI_Hs01_00063611 predicted 374
8 SASI_Hs01_00063612 predicted 479
9 SASI_Hs01_00063613 predicted 297
10 SASI_Hs01_00063614 predicted 428
11 SASI_Hs01_00063615 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106522 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219788 predicted 282
2 SASI_Rn02_00219789 predicted 338
3 SASI_Rn02_00219790 predicted 330
4 SASI_Rn02_00219791 predicted 397
5 SASI_Rn02_00219792 predicted 326
6 SASI_Rn02_00219793 predicted 328
7 SASI_Rn02_00219794 predicted 415
8 SASI_Rn02_00219795 predicted 328
9 SASI_Rn02_00219796 predicted 349
10 SASI_Rn02_00219797 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004764 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187098 predicted 208
2 SASI_Mm01_00187099 predicted 213
3 SASI_Mm01_00187100 predicted 205
4 SASI_Mm01_00187101 predicted 198
5 SASI_Mm01_00187102 predicted 216
6 SASI_Mm01_00187103 predicted 203
7 SASI_Mm01_00187104 predicted 197
8 SASI_Mm01_00187105 predicted 211
9 SASI_Mm01_00187106 predicted 311
10 SASI_Mm01_00187107 predicted 156
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177655 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140457 predicted 328
2 SASI_Mm01_00140458 predicted 324
3 SASI_Mm01_00140459 predicted 206
4 SASI_Mm01_00140460 predicted 327
5 SASI_Mm01_00140461 predicted 195
6 SASI_Mm01_00140462 predicted 325
7 SASI_Mm01_00140463 predicted 198
8 SASI_Mm01_00140464 predicted 215
9 SASI_Mm01_00140465 predicted 324
10 SASI_Mm01_00140466 predicted 373
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138283
CSTL1 MISSION shRNA Bacterial Glycerol Stock
cystatin-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138283.1-387s1c1
Sequence:CCGGCTTCATTCAATCCTACAACAACTCGAGTTGTTGTAGGATTGAATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138283.1-366s1c1
Sequence:CCGGCATGAATTCAACACTCAACTTCTCGAGAAGTTGAGTGTTGAATTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138283.1-576s1c1
Sequence:CCGGGAGTTTAATTTGCGAGTCTTTCTCGAGAAAGACTCGCAAATTAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138283.1-409s1c1
Sequence:CCGGGCCAGCAACGACACCTACTTACTCGAGTAAGTAGGTGTCGTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138283.1-575s1c2
Sequence:CCGGAGAGTTTAATTTGCGAGTCTTCTCGAGAAGACTCGCAAATTAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138283
CSTL1 MISSION shRNA shRNA Plasmid DNA
cystatin-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138283.1-387s1c1
Sequence:CCGGCTTCATTCAATCCTACAACAACTCGAGTTGTTGTAGGATTGAATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138283.1-366s1c1
Sequence:CCGGCATGAATTCAACACTCAACTTCTCGAGAAGTTGAGTGTTGAATTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138283.1-576s1c1
Sequence:CCGGGAGTTTAATTTGCGAGTCTTTCTCGAGAAAGACTCGCAAATTAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138283.1-409s1c1
Sequence:CCGGGCCAGCAACGACACCTACTTACTCGAGTAAGTAGGTGTCGTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138283.1-575s1c2
Sequence:CCGGAGAGTTTAATTTGCGAGTCTTCTCGAGAAGACTCGCAAATTAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138283
CSTL1 MISSION shRNA Lentiviral Transduction Particles
cystatin-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138283.1-387s1c1
Sequence:CCGGCTTCATTCAATCCTACAACAACTCGAGTTGTTGTAGGATTGAATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138283.1-366s1c1
Sequence:CCGGCATGAATTCAACACTCAACTTCTCGAGAAGTTGAGTGTTGAATTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138283.1-576s1c1
Sequence:CCGGGAGTTTAATTTGCGAGTCTTTCTCGAGAAAGACTCGCAAATTAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138283.1-409s1c1
Sequence:CCGGGCCAGCAACGACACCTACTTACTCGAGTAAGTAGGTGTCGTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138283.1-575s1c2
Sequence:CCGGAGAGTTTAATTTGCGAGTCTTCTCGAGAAGACTCGCAAATTAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177655
CSTL1 MISSION shRNA Bacterial Glycerol Stock
cystatin-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177655.2-337s1c1
Sequence:CCGGGACACCTACTTGTATCAAGTTCTCGAGAACTTGATACAAGTAGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177655.2-201s1c1
Sequence:CCGGGCTGGTGACTGTGGTCGTAATCTCGAGATTACGACCACAGTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177655.2-315s1c1
Sequence:CCGGCTCTTACAACAACGCAAGCAACTCGAGTTGCTTGCGTTGTTGTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177655.2-402s1c1
Sequence:CCGGGTATTTGGTTACTGTGAAGATCTCGAGATCTTCACAGTAACCAAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177655.2-285s1c1
Sequence:CCGGCATCAACTCGACACTCCATTTCTCGAGAAATGGAGTGTCGAGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177655
CSTL1 MISSION shRNA shRNA Plasmid DNA
cystatin-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177655.2-337s1c1
Sequence:CCGGGACACCTACTTGTATCAAGTTCTCGAGAACTTGATACAAGTAGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177655.2-201s1c1
Sequence:CCGGGCTGGTGACTGTGGTCGTAATCTCGAGATTACGACCACAGTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177655.2-315s1c1
Sequence:CCGGCTCTTACAACAACGCAAGCAACTCGAGTTGCTTGCGTTGTTGTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177655.2-402s1c1
Sequence:CCGGGTATTTGGTTACTGTGAAGATCTCGAGATCTTCACAGTAACCAAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177655.2-285s1c1
Sequence:CCGGCATCAACTCGACACTCCATTTCTCGAGAAATGGAGTGTCGAGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177655
CSTL1 MISSION shRNA Lentiviral Transduction Particles
cystatin-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177655.2-337s1c1
Sequence:CCGGGACACCTACTTGTATCAAGTTCTCGAGAACTTGATACAAGTAGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177655.2-201s1c1
Sequence:CCGGGCTGGTGACTGTGGTCGTAATCTCGAGATTACGACCACAGTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177655.2-315s1c1
Sequence:CCGGCTCTTACAACAACGCAAGCAACTCGAGTTGCTTGCGTTGTTGTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177655.2-402s1c1
Sequence:CCGGGTATTTGGTTACTGTGAAGATCTCGAGATCTTCACAGTAACCAAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177655.2-285s1c1
Sequence:CCGGCATCAACTCGACACTCCATTTCTCGAGAAATGGAGTGTCGAGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks