EMAIL THIS PAGE TO A FRIEND

CT45A1

cancer/testis antigen family 45, member A1

27 Gene Product Result for
Synonyms: CT45 CT45-1 CT45.1
Species: Human CT45A1(541466)
UniProtKB ID: Q5HYN5, B9EIR8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017417 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017417 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017417 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148631 MISSION® esiRNA esiRNA human CT45A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017417 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138514 predicted 414
2 SASI_Hs01_00138515 predicted 270
3 SASI_Hs01_00138516 predicted 749
4 SASI_Hs01_00138517 predicted 440
5 SASI_Hs01_00138519 predicted 492
6 SASI_Hs01_00138520 predicted 462
7 SASI_Hs02_00306745 predicted 475
8 SASI_Hs01_00138521 predicted 630
9 SASI_Hs01_00138522 predicted 524
10 SASI_Hs02_00306746 predicted 281
11 SASI_Hs01_00138518 predicted 262
12 SASI_Hs01_00138523 predicted 428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017417
CT45A1 MISSION shRNA Bacterial Glycerol Stock
cancer/testis antigen family 45, member A1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017417.1-602s21c1
Sequence:CCGGACGAGAAATTAATGCTGATATCTCGAGATATCAGCATTAATTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017417.1-793s21c1
Sequence:CCGGAGAAACTGAAACGTATGATTTCTCGAGAAATCATACGTTTCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017417.1-708s21c1
Sequence:CCGGACTGCAGTCAGGAAGCGATTTCTCGAGAAATCGCTTCCTGACTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017417.1-820s21c1
Sequence:CCGGACTTGTCCCTGGAGGATTATCCTCGAGGATAATCCTCCAGGGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017417.1-274s21c1
Sequence:CCGGTAGATCCTGAAACTGTGTTTACTCGAGTAAACACAGTTTCAGGATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017417.1-542s1c1
Sequence:CCGGCAGCAGTTTCTCTGGAGATGACTCGAGTCATCTCCAGAGAAACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017417.1-442s1c1
Sequence:CCGGCCAGCCAATTGGATTCTCAGACTCGAGTCTGAGAATCCAATTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017417
CT45A1 MISSION shRNA shRNA Plasmid DNA
cancer/testis antigen family 45, member A1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017417.1-602s21c1
Sequence:CCGGACGAGAAATTAATGCTGATATCTCGAGATATCAGCATTAATTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017417.1-793s21c1
Sequence:CCGGAGAAACTGAAACGTATGATTTCTCGAGAAATCATACGTTTCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017417.1-708s21c1
Sequence:CCGGACTGCAGTCAGGAAGCGATTTCTCGAGAAATCGCTTCCTGACTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017417.1-820s21c1
Sequence:CCGGACTTGTCCCTGGAGGATTATCCTCGAGGATAATCCTCCAGGGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017417.1-274s21c1
Sequence:CCGGTAGATCCTGAAACTGTGTTTACTCGAGTAAACACAGTTTCAGGATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017417.1-542s1c1
Sequence:CCGGCAGCAGTTTCTCTGGAGATGACTCGAGTCATCTCCAGAGAAACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017417.1-442s1c1
Sequence:CCGGCCAGCCAATTGGATTCTCAGACTCGAGTCTGAGAATCCAATTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017417
CT45A1 MISSION shRNA Lentiviral Transduction Particles
cancer/testis antigen family 45, member A1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017417.1-602s21c1
Sequence:CCGGACGAGAAATTAATGCTGATATCTCGAGATATCAGCATTAATTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017417.1-793s21c1
Sequence:CCGGAGAAACTGAAACGTATGATTTCTCGAGAAATCATACGTTTCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017417.1-708s21c1
Sequence:CCGGACTGCAGTCAGGAAGCGATTTCTCGAGAAATCGCTTCCTGACTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017417.1-820s21c1
Sequence:CCGGACTTGTCCCTGGAGGATTATCCTCGAGGATAATCCTCCAGGGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017417.1-274s21c1
Sequence:CCGGTAGATCCTGAAACTGTGTTTACTCGAGTAAACACAGTTTCAGGATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017417.1-542s1c1
Sequence:CCGGCAGCAGTTTCTCTGGAGATGACTCGAGTCATCTCCAGAGAAACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017417.1-442s1c1
Sequence:CCGGCCAGCCAATTGGATTCTCAGACTCGAGTCTGAGAATCCAATTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks