EMAIL THIS PAGE TO A FRIEND

CT45A2

cancer/testis antigen family 45, member A2

16 Gene Product Result for
Synonyms: CT45-2 CT45.2
Species: Human CT45A2(728911)
UniProtKB ID: Q5DJT8, Q5JRH3
Gene ID:
Human(728911) Summary: This gene represents one of a cluster of six similar genes located on the q arm of chromosome X. The genes in this cluster encode members of the cancer/testis (CT) family of antigens, and are distinct from other CT antigens. These antigens are thought to be novel therapeutic targets for human cancers. [provided by RefSeq, May 2010]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152582 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152582 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152582 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152582 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152582 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105220 predicted 263
2 SASI_Hs02_00366402 predicted 750
3 SASI_Hs01_00105221 predicted 437
4 SASI_Hs01_00105223 predicted 494
5 SASI_Hs01_00105224 predicted 463
6 SASI_Hs02_00366403 predicted 481
7 SASI_Hs01_00105226 predicted 632
8 SASI_Hs01_00105218 predicted 416
9 SASI_Hs02_00366404 predicted 525
10 SASI_Hs02_00366405 predicted 281
11 SASI_Hs01_00105217 predicted 266
12 SASI_Hs01_00105219 predicted 300
13 SASI_Hs01_00105222 predicted 255
14 SASI_Hs01_00105225 predicted 420
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152582
CT45A2 MISSION shRNA Bacterial Glycerol Stock
cancer/testis antigen family 45, member A2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152582.3-273s1c1
Sequence:CCGGGTAGATCCTGAAACTGTGTTTCTCGAGAAACACAGTTTCAGGATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152582.3-681s1c1
Sequence:CCGGGAAATGCTTGAAGGAGTGCAACTCGAGTTGCACTCCTTCAAGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152582.3-558s1c1
Sequence:CCGGGATGACCTAGAATGCAGAGAACTCGAGTTCTCTGCATTCTAGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152582.3-416s1c1
Sequence:CCGGGCTTATGACAGGACATGCTATCTCGAGATAGCATGTCCTGTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152582.3-485s1c1
Sequence:CCGGCAAAGATAGGATGATGCAGAACTCGAGTTCTGCATCATCCTATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152582.3-845s1c1
Sequence:CCGGCCCAAATGCATAATCTCGTTACTCGAGTAACGAGATTATGCATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152582.3-401s1c1
Sequence:CCGGGTCCAAAGCAAAGAAGCTTATCTCGAGATAAGCTTCTTTGCTTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152582.3-461s1c1
Sequence:CCGGGATTGATGACTTCACTGGTTTCTCGAGAAACCAGTGAAGTCATCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152582
CT45A2 MISSION shRNA shRNA Plasmid DNA
cancer/testis antigen family 45, member A2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152582.3-273s1c1
Sequence:CCGGGTAGATCCTGAAACTGTGTTTCTCGAGAAACACAGTTTCAGGATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152582.3-681s1c1
Sequence:CCGGGAAATGCTTGAAGGAGTGCAACTCGAGTTGCACTCCTTCAAGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152582.3-558s1c1
Sequence:CCGGGATGACCTAGAATGCAGAGAACTCGAGTTCTCTGCATTCTAGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152582.3-416s1c1
Sequence:CCGGGCTTATGACAGGACATGCTATCTCGAGATAGCATGTCCTGTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152582.3-485s1c1
Sequence:CCGGCAAAGATAGGATGATGCAGAACTCGAGTTCTGCATCATCCTATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152582.3-845s1c1
Sequence:CCGGCCCAAATGCATAATCTCGTTACTCGAGTAACGAGATTATGCATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152582.3-401s1c1
Sequence:CCGGGTCCAAAGCAAAGAAGCTTATCTCGAGATAAGCTTCTTTGCTTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152582.3-461s1c1
Sequence:CCGGGATTGATGACTTCACTGGTTTCTCGAGAAACCAGTGAAGTCATCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152582
CT45A2 MISSION shRNA Lentiviral Transduction Particles
cancer/testis antigen family 45, member A2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152582.3-273s1c1
Sequence:CCGGGTAGATCCTGAAACTGTGTTTCTCGAGAAACACAGTTTCAGGATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152582.3-681s1c1
Sequence:CCGGGAAATGCTTGAAGGAGTGCAACTCGAGTTGCACTCCTTCAAGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152582.3-558s1c1
Sequence:CCGGGATGACCTAGAATGCAGAGAACTCGAGTTCTCTGCATTCTAGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152582.3-416s1c1
Sequence:CCGGGCTTATGACAGGACATGCTATCTCGAGATAGCATGTCCTGTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152582.3-485s1c1
Sequence:CCGGCAAAGATAGGATGATGCAGAACTCGAGTTCTGCATCATCCTATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152582.3-845s1c1
Sequence:CCGGCCCAAATGCATAATCTCGTTACTCGAGTAACGAGATTATGCATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152582.3-401s1c1
Sequence:CCGGGTCCAAAGCAAAGAAGCTTATCTCGAGATAAGCTTCTTTGCTTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152582.3-461s1c1
Sequence:CCGGGATTGATGACTTCACTGGTTTCTCGAGAAACCAGTGAAGTCATCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks