EMAIL THIS PAGE TO A FRIEND

CT45A3

cancer/testis antigen family 45, member A3

Synonyms: CT45-3 CT45.3 RP13-36C9.1
Species: Human CT45A3(441519)
UniProtKB ID: Q8NHU0, B2RU20, B7ZMC9, D3DTG6
Gene ID:
15 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301842 ANTI-CT45A (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017435 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017435 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017435 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017435 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017435 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142551 predicted 265
2 SASI_Hs01_00142552 predicted 750
3 SASI_Hs01_00142553 predicted 439
4 SASI_Hs01_00142555 predicted 497
5 SASI_Hs01_00142556 predicted 465
6 SASI_Hs02_00306757 predicted 482
7 SASI_Hs01_00142557 predicted 629
8 SASI_Hs01_00142558 predicted 414
9 SASI_Hs01_00142559 predicted 523
10 SASI_Hs02_00306758 predicted 281
11 SASI_Hs01_00142554 predicted 258
12 SASI_Hs01_00142560 predicted 432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017435
CT45A3 MISSION shRNA Bacterial Glycerol Stock
cancer/testis antigen family 45, member A3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017435.1-782s1c1
Sequence:CCGGGCACCTTAAGAAGAAACTGAACTCGAGTTCAGTTTCTTCTTAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017435.1-769s1c1
Sequence:CCGGGAGACTTTGTTAAGCACCTTACTCGAGTAAGGTGCTTAACAAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017435.1-461s1c1
Sequence:CCGGGATTGATGACTTCACTGGTTTCTCGAGAAACCAGTGAAGTCATCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017435.1-485s1c1
Sequence:CCGGCAAAGATAGGATGATGCAGAACTCGAGTTCTGCATCATCCTATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017435.1-681s1c1
Sequence:CCGGGAAATGCTTGAAGGAGTGCAACTCGAGTTGCACTCCTTCAAGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017435.1-416s1c1
Sequence:CCGGGCTTATGACAGGACATGCTATCTCGAGATAGCATGTCCTGTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017435.1-750s1c1
Sequence:CCGGGCAGCAAGATGTATGAGACGACTCGAGTCGTCTCATACATCTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017435.1-736s1c1
Sequence:CCGGCCATCATCAAGGAAGCAGCAACTCGAGTTGCTGCTTCCTTGATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017435.1-529s1c1
Sequence:CCGGGAGGAAACGTTACCAGCAGTTCTCGAGAACTGCTGGTAACGTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017435.1-391s1c1
Sequence:CCGGGCTCTGCCATGTCCAAAGAAACTCGAGTTTCTTTGGACATGGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140625    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017435.1-816s1c1
Sequence:CCGGGAATACTTGTCCCTGGAGGATCTCGAGATCCTCCAGGGACAAGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017435.1-558s1c1
Sequence:CCGGGATGACCTAGAATGCAGAGAACTCGAGTTCTCTGCATTCTAGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017435
CT45A3 MISSION shRNA shRNA Plasmid DNA
cancer/testis antigen family 45, member A3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017435.1-782s1c1
Sequence:CCGGGCACCTTAAGAAGAAACTGAACTCGAGTTCAGTTTCTTCTTAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017435.1-769s1c1
Sequence:CCGGGAGACTTTGTTAAGCACCTTACTCGAGTAAGGTGCTTAACAAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017435.1-461s1c1
Sequence:CCGGGATTGATGACTTCACTGGTTTCTCGAGAAACCAGTGAAGTCATCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017435.1-485s1c1
Sequence:CCGGCAAAGATAGGATGATGCAGAACTCGAGTTCTGCATCATCCTATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017435.1-681s1c1
Sequence:CCGGGAAATGCTTGAAGGAGTGCAACTCGAGTTGCACTCCTTCAAGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017435.1-416s1c1
Sequence:CCGGGCTTATGACAGGACATGCTATCTCGAGATAGCATGTCCTGTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017435.1-750s1c1
Sequence:CCGGGCAGCAAGATGTATGAGACGACTCGAGTCGTCTCATACATCTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017435.1-736s1c1
Sequence:CCGGCCATCATCAAGGAAGCAGCAACTCGAGTTGCTGCTTCCTTGATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017435.1-529s1c1
Sequence:CCGGGAGGAAACGTTACCAGCAGTTCTCGAGAACTGCTGGTAACGTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017435.1-391s1c1
Sequence:CCGGGCTCTGCCATGTCCAAAGAAACTCGAGTTTCTTTGGACATGGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140625    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017435.1-816s1c1
Sequence:CCGGGAATACTTGTCCCTGGAGGATCTCGAGATCCTCCAGGGACAAGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017435.1-558s1c1
Sequence:CCGGGATGACCTAGAATGCAGAGAACTCGAGTTCTCTGCATTCTAGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017435
CT45A3 MISSION shRNA Lentiviral Transduction Particles
cancer/testis antigen family 45, member A3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017435.1-782s1c1
Sequence:CCGGGCACCTTAAGAAGAAACTGAACTCGAGTTCAGTTTCTTCTTAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017435.1-769s1c1
Sequence:CCGGGAGACTTTGTTAAGCACCTTACTCGAGTAAGGTGCTTAACAAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017435.1-461s1c1
Sequence:CCGGGATTGATGACTTCACTGGTTTCTCGAGAAACCAGTGAAGTCATCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017435.1-485s1c1
Sequence:CCGGCAAAGATAGGATGATGCAGAACTCGAGTTCTGCATCATCCTATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017435.1-681s1c1
Sequence:CCGGGAAATGCTTGAAGGAGTGCAACTCGAGTTGCACTCCTTCAAGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017435.1-416s1c1
Sequence:CCGGGCTTATGACAGGACATGCTATCTCGAGATAGCATGTCCTGTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017435.1-750s1c1
Sequence:CCGGGCAGCAAGATGTATGAGACGACTCGAGTCGTCTCATACATCTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017435.1-736s1c1
Sequence:CCGGCCATCATCAAGGAAGCAGCAACTCGAGTTGCTGCTTCCTTGATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017435.1-529s1c1
Sequence:CCGGGAGGAAACGTTACCAGCAGTTCTCGAGAACTGCTGGTAACGTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017435.1-391s1c1
Sequence:CCGGGCTCTGCCATGTCCAAAGAAACTCGAGTTTCTTTGGACATGGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140625    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017435.1-816s1c1
Sequence:CCGGGAATACTTGTCCCTGGAGGATCTCGAGATCCTCCAGGGACAAGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017435.1-558s1c1
Sequence:CCGGGATGACCTAGAATGCAGAGAACTCGAGTTCTCTGCATTCTAGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks