EMAIL THIS PAGE TO A FRIEND

CT45A4

cancer/testis antigen family 45, member A4

20 Gene Product Result for
Synonyms: CT45-4 CT45.4
Species: Human CT45A4(441520)
UniProtKB ID: Q8N7B7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017436 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017436 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017436 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017436 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074054 predicted 408
2 SASI_Hs01_00074056 predicted 261
3 SASI_Hs02_00306759 predicted 752
4 SASI_Hs01_00074057 predicted 437
5 SASI_Hs01_00074059 predicted 493
6 SASI_Hs01_00074060 predicted 463
7 SASI_Hs02_00306760 predicted 483
8 SASI_Hs01_00074062 predicted 631
9 SASI_Hs02_00306761 predicted 531
10 SASI_Hs02_00306762 predicted 283
11 SASI_Hs01_00074053 predicted 265
12 SASI_Hs01_00074055 predicted 298
13 SASI_Hs01_00074058 predicted 255
14 SASI_Hs01_00074061 predicted 418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017436
CT45A4 MISSION shRNA Bacterial Glycerol Stock
cancer/testis antigen family 45, member A4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017436.1-529s1c1
Sequence:CCGGGAGGAAACGTTACCAGCAGTTCTCGAGAACTGCTGGTAACGTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017436.1-845s1c1
Sequence:CCGGCCCAAATGCATAATCTCGTTACTCGAGTAACGAGATTATGCATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017436.1-401s1c1
Sequence:CCGGGTCCAAAGCAAAGAAGCTTATCTCGAGATAAGCTTCTTTGCTTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017436.1-273s1c1
Sequence:CCGGGTAGATCCTGAAACTGTGTTTCTCGAGAAACACAGTTTCAGGATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017436.1-777s1c1
Sequence:CCGGGTTAAGCACCTTAAGAAGAAACTCGAGTTTCTTCTTAAGGTGCTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017436.1-783s1c1
Sequence:CCGGCACCTTAAGAAGAAACTGAAACTCGAGTTTCAGTTTCTTCTTAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017436.1-769s1c1
Sequence:CCGGGAGACTTTGTTAAGCACCTTACTCGAGTAAGGTGCTTAACAAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017436.1-599s1c1
Sequence:CCGGCCAACAAGAAATTAATGCTGACTCGAGTCAGCATTAATTTCTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160286    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017436.1-846s1c1
Sequence:CCGGCCAAATGCATAATCTCGTTAACTCGAGTTAACGAGATTATGCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017436.1-485s1c1
Sequence:CCGGCAAAGATAGGATGATGCAGAACTCGAGTTCTGCATCATCCTATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017436.1-558s1c1
Sequence:CCGGGATGACCTAGAATGCAGAGAACTCGAGTTCTCTGCATTCTAGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017436.1-306s1c1
Sequence:CCGGGAATGTGACAGTCCTTCGTATCTCGAGATACGAAGGACTGTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017436
CT45A4 MISSION shRNA shRNA Plasmid DNA
cancer/testis antigen family 45, member A4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017436.1-529s1c1
Sequence:CCGGGAGGAAACGTTACCAGCAGTTCTCGAGAACTGCTGGTAACGTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017436.1-845s1c1
Sequence:CCGGCCCAAATGCATAATCTCGTTACTCGAGTAACGAGATTATGCATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017436.1-401s1c1
Sequence:CCGGGTCCAAAGCAAAGAAGCTTATCTCGAGATAAGCTTCTTTGCTTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017436.1-273s1c1
Sequence:CCGGGTAGATCCTGAAACTGTGTTTCTCGAGAAACACAGTTTCAGGATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017436.1-777s1c1
Sequence:CCGGGTTAAGCACCTTAAGAAGAAACTCGAGTTTCTTCTTAAGGTGCTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017436.1-783s1c1
Sequence:CCGGCACCTTAAGAAGAAACTGAAACTCGAGTTTCAGTTTCTTCTTAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017436.1-769s1c1
Sequence:CCGGGAGACTTTGTTAAGCACCTTACTCGAGTAAGGTGCTTAACAAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017436.1-599s1c1
Sequence:CCGGCCAACAAGAAATTAATGCTGACTCGAGTCAGCATTAATTTCTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160286    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017436.1-846s1c1
Sequence:CCGGCCAAATGCATAATCTCGTTAACTCGAGTTAACGAGATTATGCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017436.1-485s1c1
Sequence:CCGGCAAAGATAGGATGATGCAGAACTCGAGTTCTGCATCATCCTATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017436.1-558s1c1
Sequence:CCGGGATGACCTAGAATGCAGAGAACTCGAGTTCTCTGCATTCTAGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017436.1-306s1c1
Sequence:CCGGGAATGTGACAGTCCTTCGTATCTCGAGATACGAAGGACTGTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017436
CT45A4 MISSION shRNA Lentiviral Transduction Particles
cancer/testis antigen family 45, member A4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017436.1-529s1c1
Sequence:CCGGGAGGAAACGTTACCAGCAGTTCTCGAGAACTGCTGGTAACGTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017436.1-845s1c1
Sequence:CCGGCCCAAATGCATAATCTCGTTACTCGAGTAACGAGATTATGCATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017436.1-401s1c1
Sequence:CCGGGTCCAAAGCAAAGAAGCTTATCTCGAGATAAGCTTCTTTGCTTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017436.1-273s1c1
Sequence:CCGGGTAGATCCTGAAACTGTGTTTCTCGAGAAACACAGTTTCAGGATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017436.1-777s1c1
Sequence:CCGGGTTAAGCACCTTAAGAAGAAACTCGAGTTTCTTCTTAAGGTGCTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017436.1-783s1c1
Sequence:CCGGCACCTTAAGAAGAAACTGAAACTCGAGTTTCAGTTTCTTCTTAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017436.1-769s1c1
Sequence:CCGGGAGACTTTGTTAAGCACCTTACTCGAGTAAGGTGCTTAACAAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017436.1-599s1c1
Sequence:CCGGCCAACAAGAAATTAATGCTGACTCGAGTCAGCATTAATTTCTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160286    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017436.1-846s1c1
Sequence:CCGGCCAAATGCATAATCTCGTTAACTCGAGTTAACGAGATTATGCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017436.1-485s1c1
Sequence:CCGGCAAAGATAGGATGATGCAGAACTCGAGTTCTGCATCATCCTATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017436.1-558s1c1
Sequence:CCGGGATGACCTAGAATGCAGAGAACTCGAGTTCTCTGCATTCTAGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017436.1-306s1c1
Sequence:CCGGGAATGTGACAGTCCTTCGTATCTCGAGATACGAAGGACTGTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks