EMAIL THIS PAGE TO A FRIEND

CT45A5

cancer/testis antigen family 45, member A5

14 Gene Product Result for
Synonyms: CT45.5 CT455
Species: Human CT45A5(441521)
UniProtKB ID: Q6NSH3, A8K842, B7ZMC5
Gene ID:
Human(441521) Summary: This gene represents one of a cluster of six similar genes located on the q arm of chromosome X. The genes in this cluster encode members of the cancer/testis (CT) family of antigens, and are distinct from other CT antigens. These antigens are thought to be novel therapeutic targets for human cancers. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 5. [provided by RefSeq, May 2010]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007551 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007551 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007551 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007551 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111794 predicted 264
2 SASI_Hs01_00111795 predicted 498
3 SASI_Hs01_00111796 predicted 753
4 SASI_Hs01_00111797 predicted 437
5 SASI_Hs01_00111799 predicted 525
6 SASI_Hs01_00111800 predicted 464
7 SASI_Hs01_00111801 predicted 411
8 SASI_Hs01_00111802 predicted 510
9 SASI_Hs02_00305341 predicted 284
10 SASI_Hs02_00305342 predicted 557
11 SASI_Hs01_00111798 predicted 255
12 SASI_Hs01_00111803 predicted 432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007551
CT45A5 MISSION shRNA Bacterial Glycerol Stock
cancer/testis antigen family 45, member A5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007551.1-581s1c1
Sequence:CCGGCCATCATCAAGGAAGCAGCAACTCGAGTTGCTGCTTCCTTGATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007551.1-342s1c1
Sequence:CCGGGATGCAGAAACCTGGTAGCAACTCGAGTTGCTACCAGGTTTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007551.1-481s1c1
Sequence:CCGGGTGAAGGAAATCCGATGCCTTCTCGAGAAGGCATCGGATTTCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007551.1-526s1c1
Sequence:CCGGGAAATGCTTGAAGGAGTGCAACTCGAGTTGCACTCCTTCAAGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007551.1-627s1c1
Sequence:CCGGGCACCTTAAGAAGAAACTGAACTCGAGTTCAGTTTCTTCTTAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007551.1-374s1c1
Sequence:CCGGGAGGAAATGTTACCAGCAATTCTCGAGAATTGCTGGTAACATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007551.1-306s1c1
Sequence:CCGGGATTGATGACTTCACTGGTTTCTCGAGAAACCAGTGAAGTCATCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007551.1-605s1c1
Sequence:CCGGGTATGAGACGAGACTTTGTTACTCGAGTAACAAAGTCTCGTCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007551.1-261s1c1
Sequence:CCGGGCTTATGACAGGACATGCTATCTCGAGATAGCATGTCCTGTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007551.1-236s1c1
Sequence:CCGGGCTCTGCCATGTCCAAAGAAACTCGAGTTTCTTTGGACATGGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007551.1-661s1c1
Sequence:CCGGGAATACTTGTCCCTGGAGGATCTCGAGATCCTCCAGGGACAAGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007551
CT45A5 MISSION shRNA shRNA Plasmid DNA
cancer/testis antigen family 45, member A5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007551.1-581s1c1
Sequence:CCGGCCATCATCAAGGAAGCAGCAACTCGAGTTGCTGCTTCCTTGATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007551.1-342s1c1
Sequence:CCGGGATGCAGAAACCTGGTAGCAACTCGAGTTGCTACCAGGTTTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007551.1-481s1c1
Sequence:CCGGGTGAAGGAAATCCGATGCCTTCTCGAGAAGGCATCGGATTTCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007551.1-526s1c1
Sequence:CCGGGAAATGCTTGAAGGAGTGCAACTCGAGTTGCACTCCTTCAAGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007551.1-627s1c1
Sequence:CCGGGCACCTTAAGAAGAAACTGAACTCGAGTTCAGTTTCTTCTTAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007551.1-374s1c1
Sequence:CCGGGAGGAAATGTTACCAGCAATTCTCGAGAATTGCTGGTAACATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007551.1-306s1c1
Sequence:CCGGGATTGATGACTTCACTGGTTTCTCGAGAAACCAGTGAAGTCATCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007551.1-605s1c1
Sequence:CCGGGTATGAGACGAGACTTTGTTACTCGAGTAACAAAGTCTCGTCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007551.1-261s1c1
Sequence:CCGGGCTTATGACAGGACATGCTATCTCGAGATAGCATGTCCTGTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007551.1-236s1c1
Sequence:CCGGGCTCTGCCATGTCCAAAGAAACTCGAGTTTCTTTGGACATGGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007551.1-661s1c1
Sequence:CCGGGAATACTTGTCCCTGGAGGATCTCGAGATCCTCCAGGGACAAGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007551
CT45A5 MISSION shRNA Lentiviral Transduction Particles
cancer/testis antigen family 45, member A5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007551.1-581s1c1
Sequence:CCGGCCATCATCAAGGAAGCAGCAACTCGAGTTGCTGCTTCCTTGATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007551.1-342s1c1
Sequence:CCGGGATGCAGAAACCTGGTAGCAACTCGAGTTGCTACCAGGTTTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007551.1-481s1c1
Sequence:CCGGGTGAAGGAAATCCGATGCCTTCTCGAGAAGGCATCGGATTTCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007551.1-526s1c1
Sequence:CCGGGAAATGCTTGAAGGAGTGCAACTCGAGTTGCACTCCTTCAAGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007551.1-627s1c1
Sequence:CCGGGCACCTTAAGAAGAAACTGAACTCGAGTTCAGTTTCTTCTTAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007551.1-374s1c1
Sequence:CCGGGAGGAAATGTTACCAGCAATTCTCGAGAATTGCTGGTAACATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007551.1-306s1c1
Sequence:CCGGGATTGATGACTTCACTGGTTTCTCGAGAAACCAGTGAAGTCATCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007551.1-605s1c1
Sequence:CCGGGTATGAGACGAGACTTTGTTACTCGAGTAACAAAGTCTCGTCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007551.1-261s1c1
Sequence:CCGGGCTTATGACAGGACATGCTATCTCGAGATAGCATGTCCTGTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007551.1-236s1c1
Sequence:CCGGGCTCTGCCATGTCCAAAGAAACTCGAGTTTCTTTGGACATGGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007551.1-661s1c1
Sequence:CCGGGAATACTTGTCCCTGGAGGATCTCGAGATCCTCCAGGGACAAGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks