EMAIL THIS PAGE TO A FRIEND

CT45A6

cancer/testis antigen family 45, member A6

22 Gene Product Result for
Synonyms: CT45-6 CT45.6
Species: Human CT45A6(541465)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305664 ANTI-CT45 FAMILY(CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017438 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017438 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017438 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017438 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306764 predicted 409
2 SASI_Hs02_00306765 predicted 268
3 SASI_Hs02_00306766 predicted 748
4 SASI_Hs02_00306767 predicted 445
5 SASI_Hs02_00306768 predicted 496
6 SASI_Hs02_00306769 predicted 459
7 SASI_Hs02_00306770 predicted 483
8 SASI_Hs02_00306771 predicted 628
9 SASI_Hs02_00306772 predicted 524
10 SASI_Hs02_00306773 predicted 288
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017438
CT45A6 MISSION shRNA Bacterial Glycerol Stock
cancer/testis antigen family 45, member A6
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000282165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017438.1-708s21c1
Sequence:CCGGACTGCAGTCAGGAAACGATTTCTCGAGAAATCGTTTCCTGACTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017438.1-417s21c1
Sequence:CCGGCTTATGACAGGACATGCTATTCTCGAGAATAGCATGTCCTGTCATAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017438.1-794s21c1
Sequence:CCGGGAAACTGAAACGTATGATTTGCTCGAGCAAATCATACGTTTCAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017438.1-819s21c1
Sequence:CCGGTACTTGTCCCTGGAGGATTATCTCGAGATAATCCTCCAGGGACAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017438
CT45A6 MISSION shRNA shRNA Plasmid DNA
cancer/testis antigen family 45, member A6
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000282165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017438.1-708s21c1
Sequence:CCGGACTGCAGTCAGGAAACGATTTCTCGAGAAATCGTTTCCTGACTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017438.1-417s21c1
Sequence:CCGGCTTATGACAGGACATGCTATTCTCGAGAATAGCATGTCCTGTCATAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017438.1-794s21c1
Sequence:CCGGGAAACTGAAACGTATGATTTGCTCGAGCAAATCATACGTTTCAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017438.1-819s21c1
Sequence:CCGGTACTTGTCCCTGGAGGATTATCTCGAGATAATCCTCCAGGGACAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017438
CT45A6 MISSION shRNA Lentiviral Transduction Particles
cancer/testis antigen family 45, member A6
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000282165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017438.1-708s21c1
Sequence:CCGGACTGCAGTCAGGAAACGATTTCTCGAGAAATCGTTTCCTGACTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017438.1-417s21c1
Sequence:CCGGCTTATGACAGGACATGCTATTCTCGAGAATAGCATGTCCTGTCATAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017438.1-794s21c1
Sequence:CCGGGAAACTGAAACGTATGATTTGCTCGAGCAAATCATACGTTTCAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017438.1-819s21c1
Sequence:CCGGTACTTGTCCCTGGAGGATTATCTCGAGATAATCCTCCAGGGACAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)