EMAIL THIS PAGE TO A FRIEND

CT47A11

cancer/testis antigen family 47, member A11

25 Gene Product Result for
Synonyms: CT47.11
Species: Human CT47A11(255313)
Gene ID:
Human(255313) Summary: This locus represents a member of the cancer/testis gene family 47. This family, also known as CT47, is comprised of 13 nearly identical loci clustered at Xq24. [provided by RefSeq, Sep 2010]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173571 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173571 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173571 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU117761 MISSION® esiRNA esiRNA human RP6-166C19.8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173571 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152563 predicted 994
2 SASI_Hs01_00152564 predicted 942
3 SASI_Hs01_00152565 predicted 1020
4 SASI_Hs01_00152566 predicted 990
5 SASI_Hs01_00152567 predicted 957
6 SASI_Hs01_00152568 predicted 927
7 SASI_Hs01_00152569 predicted 936
8 SASI_Hs01_00152570 predicted 932
9 SASI_Hs01_00152571 predicted 936
10 SASI_Hs01_00152572 predicted 988
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173571
CT47A11 MISSION shRNA Bacterial Glycerol Stock
cancer/testis antigen family 47, member A11
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173571.2-628s21c1
Sequence:CCGGGACATGGTCCACTCCCTTCTCCTCGAGGAGAAGGGAGTGGACCATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173571.2-947s21c1
Sequence:CCGGAGGAACCGGCCACAGAAGAACCTCGAGGTTCTTCTGTGGCCGGTTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173571.2-604s21c1
Sequence:CCGGTCGGGCATTCACTTCGTGCTCCTCGAGGAGCACGAAGTGAATGCCCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173571.1-1131s1c1
Sequence:CCGGAGCAGAGGTGAAGCCAAGAAACTCGAGTTTCTTGGCTTCACCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173571.1-679s1c1
Sequence:CCGGCCTCATAGAGAACCGTCAACTCTCGAGAGTTGACGGTTCTCTATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173571.1-1105s1c1
Sequence:CCGGGAAGAACTCCAAAGGGACCTACTCGAGTAGGTCCCTTTGGAGTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173571.1-1005s1c1
Sequence:CCGGTCACTAAATCTCAGCCCGAAACTCGAGTTTCGGGCTGAGATTTAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173571.1-658s1c1
Sequence:CCGGCCTCTCTCACAACGACCACATCTCGAGATGTGGTCGTTGTGAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173571
CT47A11 MISSION shRNA shRNA Plasmid DNA
cancer/testis antigen family 47, member A11
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173571.2-628s21c1
Sequence:CCGGGACATGGTCCACTCCCTTCTCCTCGAGGAGAAGGGAGTGGACCATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173571.2-947s21c1
Sequence:CCGGAGGAACCGGCCACAGAAGAACCTCGAGGTTCTTCTGTGGCCGGTTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173571.2-604s21c1
Sequence:CCGGTCGGGCATTCACTTCGTGCTCCTCGAGGAGCACGAAGTGAATGCCCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173571.1-1131s1c1
Sequence:CCGGAGCAGAGGTGAAGCCAAGAAACTCGAGTTTCTTGGCTTCACCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173571.1-679s1c1
Sequence:CCGGCCTCATAGAGAACCGTCAACTCTCGAGAGTTGACGGTTCTCTATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173571.1-1105s1c1
Sequence:CCGGGAAGAACTCCAAAGGGACCTACTCGAGTAGGTCCCTTTGGAGTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173571.1-1005s1c1
Sequence:CCGGTCACTAAATCTCAGCCCGAAACTCGAGTTTCGGGCTGAGATTTAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173571.1-658s1c1
Sequence:CCGGCCTCTCTCACAACGACCACATCTCGAGATGTGGTCGTTGTGAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173571
CT47A11 MISSION shRNA Lentiviral Transduction Particles
cancer/testis antigen family 47, member A11
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173571.2-628s21c1
Sequence:CCGGGACATGGTCCACTCCCTTCTCCTCGAGGAGAAGGGAGTGGACCATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173571.2-947s21c1
Sequence:CCGGAGGAACCGGCCACAGAAGAACCTCGAGGTTCTTCTGTGGCCGGTTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173571.2-604s21c1
Sequence:CCGGTCGGGCATTCACTTCGTGCTCCTCGAGGAGCACGAAGTGAATGCCCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173571.1-1131s1c1
Sequence:CCGGAGCAGAGGTGAAGCCAAGAAACTCGAGTTTCTTGGCTTCACCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173571.1-679s1c1
Sequence:CCGGCCTCATAGAGAACCGTCAACTCTCGAGAGTTGACGGTTCTCTATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173571.1-1105s1c1
Sequence:CCGGGAAGAACTCCAAAGGGACCTACTCGAGTAGGTCCCTTTGGAGTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173571.1-1005s1c1
Sequence:CCGGTCACTAAATCTCAGCCCGAAACTCGAGTTTCGGGCTGAGATTTAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173571.1-658s1c1
Sequence:CCGGCCTCTCTCACAACGACCACATCTCGAGATGTGGTCGTTGTGAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)