EMAIL THIS PAGE TO A FRIEND

CT47A1

cancer/testis antigen family 47, member A1

23 Gene Product Result for
Synonyms: CT47.1
Species: Human CT47A1(728096)
UniProtKB ID: Q5JQC4, Q8N747
Gene ID:
Human(728096) Summary: This locus represents a member of the cancer/testis gene family 47. This family, also known as CT47, is comprised of 13 nearly identical loci clustered at Xq24. This locus is the most telomeric of the cluster.[provided by RefSeq, Sep 2010]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080146 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080146 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080146 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080146 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080146 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314331 predicted 1154
2 SASI_Hs02_00314332 predicted 997
3 SASI_Hs02_00314333 predicted 941
4 SASI_Hs02_00314334 predicted 1178
5 SASI_Hs02_00314335 predicted 1178
6 SASI_Hs02_00314336 predicted 1219
7 SASI_Hs02_00314337 predicted 601
8 SASI_Hs02_00314338 predicted 1024
9 SASI_Hs02_00314339 predicted 958
10 SASI_Hs02_00314340 predicted 931
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080146
CT47A1 MISSION shRNA Bacterial Glycerol Stock
cancer/testis antigen family 47, member A1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080146.1-496s21c1
Sequence:CCGGGCCGAGGAGGACTCAGATATCCTCGAGGATATCTGAGTCCTCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080146.1-1054s21c1
Sequence:CCGGGAGGAAGAGAAAGAACAAGAACTCGAGTTCTTGTTCTTTCTCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080146.1-991s21c1
Sequence:CCGGCCAGAGGAAGTCACTAAATCTCTCGAGAGATTTAGTGACTTCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080146.1-1104s21c1
Sequence:CCGGGAACTCCAAAGGGACCTAGACCTCGAGGTCTAGGTCCCTTTGGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080146.1-663s21c1
Sequence:CCGGCAACGACCACATCCTCATAGACTCGAGTCTATGAGGATGTGGTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080146
CT47A1 MISSION shRNA shRNA Plasmid DNA
cancer/testis antigen family 47, member A1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080146.1-496s21c1
Sequence:CCGGGCCGAGGAGGACTCAGATATCCTCGAGGATATCTGAGTCCTCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080146.1-1054s21c1
Sequence:CCGGGAGGAAGAGAAAGAACAAGAACTCGAGTTCTTGTTCTTTCTCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080146.1-991s21c1
Sequence:CCGGCCAGAGGAAGTCACTAAATCTCTCGAGAGATTTAGTGACTTCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080146.1-1104s21c1
Sequence:CCGGGAACTCCAAAGGGACCTAGACCTCGAGGTCTAGGTCCCTTTGGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080146.1-663s21c1
Sequence:CCGGCAACGACCACATCCTCATAGACTCGAGTCTATGAGGATGTGGTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080146
CT47A1 MISSION shRNA Lentiviral Transduction Particles
cancer/testis antigen family 47, member A1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080146.1-496s21c1
Sequence:CCGGGCCGAGGAGGACTCAGATATCCTCGAGGATATCTGAGTCCTCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080146.1-1054s21c1
Sequence:CCGGGAGGAAGAGAAAGAACAAGAACTCGAGTTCTTGTTCTTTCTCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080146.1-991s21c1
Sequence:CCGGCCAGAGGAAGTCACTAAATCTCTCGAGAGATTTAGTGACTTCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080146.1-1104s21c1
Sequence:CCGGGAACTCCAAAGGGACCTAGACCTCGAGGTCTAGGTCCCTTTGGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080146.1-663s21c1
Sequence:CCGGCAACGACCACATCCTCATAGACTCGAGTCTATGAGGATGTGGTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks