EMAIL THIS PAGE TO A FRIEND

CT47A2

cancer/testis antigen family 47, member A2

12 Gene Product Result for
Synonyms: CT47.2
Species: Human CT47A2(728090)
Gene ID:
Human(728090) Summary: This locus represents a member of the cancer/testis gene family 47. This family, also known as CT47, is comprised of 13 nearly identical loci clustered at Xq24. [provided by RefSeq, Sep 2010]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080145 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080145 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080145 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080145 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080145 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314321 predicted 999
2 SASI_Hs02_00314322 predicted 936
3 SASI_Hs02_00314323 predicted 1016
4 SASI_Hs02_00314324 predicted 990
5 SASI_Hs02_00314325 predicted 955
6 SASI_Hs02_00314326 predicted 927
7 SASI_Hs02_00314327 predicted 939
8 SASI_Hs02_00314328 predicted 932
9 SASI_Hs02_00314329 predicted 937
10 SASI_Hs02_00314330 predicted 991
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080145
CT47A2 MISSION shRNA Bacterial Glycerol Stock
cancer/testis antigen family 47, member A2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080145.1-1024s21c1
Sequence:CCGGTGGGATGAAGAGGCCCAAGATCTCGAGATCTTGGGCCTCTTCATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080145.1-1094s21c1
Sequence:CCGGACAAGGTGAAGAACTCCAAAGCTCGAGCTTTGGAGTTCTTCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080145.1-1055s21c1
Sequence:CCGGAGGAAGAGAAAGAACAAGAAACTCGAGTTTCTTGTTCTTTCTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080145.1-990s21c1
Sequence:CCGGCCCAGAGGAAGTCACTAAATCCTCGAGGATTTAGTGACTTCCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080145.1-662s21c1
Sequence:CCGGACAACGACCACATCCTCATAGCTCGAGCTATGAGGATGTGGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080145
CT47A2 MISSION shRNA shRNA Plasmid DNA
cancer/testis antigen family 47, member A2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080145.1-1024s21c1
Sequence:CCGGTGGGATGAAGAGGCCCAAGATCTCGAGATCTTGGGCCTCTTCATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080145.1-1094s21c1
Sequence:CCGGACAAGGTGAAGAACTCCAAAGCTCGAGCTTTGGAGTTCTTCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080145.1-1055s21c1
Sequence:CCGGAGGAAGAGAAAGAACAAGAAACTCGAGTTTCTTGTTCTTTCTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080145.1-990s21c1
Sequence:CCGGCCCAGAGGAAGTCACTAAATCCTCGAGGATTTAGTGACTTCCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080145.1-662s21c1
Sequence:CCGGACAACGACCACATCCTCATAGCTCGAGCTATGAGGATGTGGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080145
CT47A2 MISSION shRNA Lentiviral Transduction Particles
cancer/testis antigen family 47, member A2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080145.1-1024s21c1
Sequence:CCGGTGGGATGAAGAGGCCCAAGATCTCGAGATCTTGGGCCTCTTCATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080145.1-1094s21c1
Sequence:CCGGACAAGGTGAAGAACTCCAAAGCTCGAGCTTTGGAGTTCTTCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080145.1-1055s21c1
Sequence:CCGGAGGAAGAGAAAGAACAAGAAACTCGAGTTTCTTGTTCTTTCTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080145.1-990s21c1
Sequence:CCGGCCCAGAGGAAGTCACTAAATCCTCGAGGATTTAGTGACTTCCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080145.1-662s21c1
Sequence:CCGGACAACGACCACATCCTCATAGCTCGAGCTATGAGGATGTGGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks