EMAIL THIS PAGE TO A FRIEND

CT47A3

cancer/testis antigen family 47, member A3

12 Gene Product Result for
Synonyms: CT47.3
Species: Human CT47A3(728082)
Gene ID:
Human(728082) Summary: This locus represents a member of the cancer/testis gene family 47. This family, also known as CT47, is comprised of 13 nearly identical loci clustered at Xq24. [provided by RefSeq, Sep 2010]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080144 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080144 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080144 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080144 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080144 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314311 predicted 997
2 SASI_Hs02_00314312 predicted 936
3 SASI_Hs02_00314313 predicted 1018
4 SASI_Hs02_00314314 predicted 982
5 SASI_Hs02_00314315 predicted 957
6 SASI_Hs02_00314316 predicted 930
7 SASI_Hs02_00314317 predicted 938
8 SASI_Hs02_00314318 predicted 939
9 SASI_Hs02_00314319 predicted 939
10 SASI_Hs02_00314320 predicted 986
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080144
CT47A3 MISSION shRNA Bacterial Glycerol Stock
cancer/testis antigen family 47, member A3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080144.1-1119s21c1
Sequence:CCGGCTAGACGCAGCAGAGGTGAAGCTCGAGCTTCACCTCTGCTGCGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080144.1-667s21c1
Sequence:CCGGGACCACATCCTCATAGAGAACCTCGAGGTTCTCTATGAGGATGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080144.1-1025s21c1
Sequence:CCGGGGGATGAAGAGGCCCAAGATGCTCGAGCATCTTGGGCCTCTTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080144.1-995s21c1
Sequence:CCGGAGGAAGTCACTAAATCTCAGCCTCGAGGCTGAGATTTAGTGACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080144.1-679s21c1
Sequence:CCGGATAGAGAACCGTCAACTCAGCCTCGAGGCTGAGTTGACGGTTCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080144
CT47A3 MISSION shRNA shRNA Plasmid DNA
cancer/testis antigen family 47, member A3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080144.1-1119s21c1
Sequence:CCGGCTAGACGCAGCAGAGGTGAAGCTCGAGCTTCACCTCTGCTGCGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080144.1-667s21c1
Sequence:CCGGGACCACATCCTCATAGAGAACCTCGAGGTTCTCTATGAGGATGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080144.1-1025s21c1
Sequence:CCGGGGGATGAAGAGGCCCAAGATGCTCGAGCATCTTGGGCCTCTTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080144.1-995s21c1
Sequence:CCGGAGGAAGTCACTAAATCTCAGCCTCGAGGCTGAGATTTAGTGACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080144.1-679s21c1
Sequence:CCGGATAGAGAACCGTCAACTCAGCCTCGAGGCTGAGTTGACGGTTCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080144
CT47A3 MISSION shRNA Lentiviral Transduction Particles
cancer/testis antigen family 47, member A3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080144.1-1119s21c1
Sequence:CCGGCTAGACGCAGCAGAGGTGAAGCTCGAGCTTCACCTCTGCTGCGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080144.1-667s21c1
Sequence:CCGGGACCACATCCTCATAGAGAACCTCGAGGTTCTCTATGAGGATGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080144.1-1025s21c1
Sequence:CCGGGGGATGAAGAGGCCCAAGATGCTCGAGCATCTTGGGCCTCTTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080144.1-995s21c1
Sequence:CCGGAGGAAGTCACTAAATCTCAGCCTCGAGGCTGAGATTTAGTGACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080144.1-679s21c1
Sequence:CCGGATAGAGAACCGTCAACTCAGCCTCGAGGCTGAGTTGACGGTTCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks